Incidental Mutation 'R6972:Ptprj'
ID542283
Institutional Source Beutler Lab
Gene Symbol Ptprj
Ensembl Gene ENSMUSG00000025314
Gene Nameprotein tyrosine phosphatase, receptor type, J
SynonymsCD148, Byp, Scc1, Scc-1, DEP-1, RPTPJ
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.187) question?
Stock #R6972 (G1)
Quality Score111.035
Status Not validated
Chromosome2
Chromosomal Location90429754-90580647 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 90580403 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 62 (S62F)
Ref Sequence ENSEMBL: ENSMUSP00000129592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168621]
Predicted Effect possibly damaging
Transcript: ENSMUST00000168621
AA Change: S62F

PolyPhen 2 Score 0.914 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000129592
Gene: ENSMUSG00000025314
AA Change: S62F

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
low complexity region 26 94 N/A INTRINSIC
low complexity region 133 140 N/A INTRINSIC
FN3 152 224 2.85e-6 SMART
FN3 233 368 3.76e-6 SMART
FN3 380 457 4.56e-5 SMART
FN3 468 543 5.32e-6 SMART
FN3 554 632 2.19e-7 SMART
FN3 641 717 5e-2 SMART
FN3 732 814 2.77e1 SMART
low complexity region 823 836 N/A INTRINSIC
Blast:PTPc 900 983 1e-25 BLAST
PTPc 1053 1313 3.37e-133 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.0%
  • 20x: 95.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes, including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region containing five fibronectin type III repeats, a single transmembrane region, and a single intracytoplasmic catalytic domain, and thus represents a receptor-type PTP. This protein is present in all hematopoietic lineages, and was shown to negatively regulate T cell receptor signaling possibly through interfering with the phosphorylation of Phospholipase C Gamma 1 and Linker for Activation of T Cells. This protein can also dephosphorylate the PDGF beta receptor, and may be involved in UV-induced signal transduction. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele die in utero displaying severe growth retardation and cardiovascular defects. Homozygotes for a second null allele are viable, fertile and healthy with no spontaneous tumor formation. Homozygotes for a third null allele show sterility and a block B cell development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,326,109 Y218N probably damaging Het
Abhd2 A G 7: 79,354,027 S285G probably benign Het
Afg1l T C 10: 42,478,374 T10A probably benign Het
Akap9 A G 5: 4,046,699 N2525D possibly damaging Het
B3gnt7 G A 1: 86,305,387 M1I probably null Het
Bdp1 T C 13: 100,037,761 E2089G probably null Het
Calcrl T G 2: 84,368,578 I156L probably benign Het
Cd69 T C 6: 129,269,580 S122G probably benign Het
Chek2 T C 5: 110,855,839 probably null Het
Ckap5 T A 2: 91,606,313 I1586K probably damaging Het
Cyp4f14 C T 17: 32,905,509 A523T probably benign Het
Dcaf1 T A 9: 106,846,772 C466* probably null Het
Dcdc2a A T 13: 25,120,389 probably benign Het
Eml5 T C 12: 98,876,180 I220V probably benign Het
Etv2 T C 7: 30,634,742 N189D probably benign Het
Fam19a2 A G 10: 123,704,373 T45A probably benign Het
Fuz T C 7: 44,897,331 probably benign Het
Git1 T G 11: 77,499,521 V64G probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gpr162 C T 6: 124,861,309 R126H probably damaging Het
Grm5 T C 7: 87,602,923 V127A probably benign Het
Iqsec1 T C 6: 90,676,768 D665G probably damaging Het
Kcnh1 A G 1: 192,276,836 I233V probably damaging Het
Lmcd1 C T 6: 112,310,698 T115I probably damaging Het
Mybpc1 T C 10: 88,560,361 E208G possibly damaging Het
Nfic C A 10: 81,420,357 A158S probably benign Het
Nos3 A T 5: 24,380,243 I798L probably benign Het
Ntrk1 A T 3: 87,783,981 L292Q probably damaging Het
Olfr698 A G 7: 106,752,699 S230P possibly damaging Het
Orc4 T C 2: 48,927,184 Q164R probably benign Het
Pcdhb14 T A 18: 37,449,692 V617E probably damaging Het
Plscr3 G A 11: 69,847,958 E149K probably damaging Het
Pltp A G 2: 164,846,592 probably null Het
Pramef6 A G 4: 143,896,902 L234P probably damaging Het
Prg2 G A 2: 84,982,273 R109H probably benign Het
Skint3 T A 4: 112,258,892 S240T probably damaging Het
Smarca5 A G 8: 80,704,751 Y946H probably damaging Het
Taf4b T C 18: 14,813,347 V409A possibly damaging Het
Trim29 T A 9: 43,327,112 N504K probably benign Het
Vmn2r77 T C 7: 86,802,994 Y461H probably damaging Het
Zeb2 T C 2: 44,997,318 K531E probably damaging Het
Zfp687 A G 3: 95,009,377 S813P possibly damaging Het
Other mutations in Ptprj
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01528:Ptprj APN 2 90452144 missense probably damaging 1.00
IGL01594:Ptprj APN 2 90440795 splice site probably benign
IGL01767:Ptprj APN 2 90469574 missense probably benign 0.11
IGL01917:Ptprj APN 2 90469749 missense probably damaging 1.00
IGL01981:Ptprj APN 2 90439912 missense probably damaging 1.00
IGL02830:Ptprj APN 2 90453144 missense probably benign 0.22
IGL02955:Ptprj APN 2 90468464 critical splice acceptor site probably null
IGL03102:Ptprj APN 2 90478968 missense probably benign 0.02
IGL03150:Ptprj APN 2 90460611 missense probably damaging 0.98
IGL03210:Ptprj APN 2 90469726 missense probably benign 0.01
IGL02799:Ptprj UTSW 2 90469598 missense probably benign 0.00
R0083:Ptprj UTSW 2 90469777 splice site probably null
R0108:Ptprj UTSW 2 90469777 splice site probably null
R0579:Ptprj UTSW 2 90436569 critical splice acceptor site probably null
R1130:Ptprj UTSW 2 90453421 missense probably damaging 1.00
R1160:Ptprj UTSW 2 90444524 missense probably damaging 1.00
R1238:Ptprj UTSW 2 90444414 splice site probably null
R1507:Ptprj UTSW 2 90471287 missense possibly damaging 0.87
R1552:Ptprj UTSW 2 90471153 missense probably damaging 0.98
R1607:Ptprj UTSW 2 90463320 missense probably benign 0.14
R1693:Ptprj UTSW 2 90449797 nonsense probably null
R2016:Ptprj UTSW 2 90464614 missense probably damaging 1.00
R2017:Ptprj UTSW 2 90464614 missense probably damaging 1.00
R2044:Ptprj UTSW 2 90463095 missense probably damaging 0.96
R2322:Ptprj UTSW 2 90471129 missense probably benign 0.06
R2516:Ptprj UTSW 2 90474996 splice site probably benign
R3106:Ptprj UTSW 2 90440631 missense probably damaging 1.00
R3964:Ptprj UTSW 2 90468441 missense probably benign 0.00
R4201:Ptprj UTSW 2 90463095 missense probably damaging 0.99
R4533:Ptprj UTSW 2 90439955 missense probably damaging 1.00
R4680:Ptprj UTSW 2 90460496 missense probably benign 0.00
R4738:Ptprj UTSW 2 90440643 missense probably damaging 1.00
R4983:Ptprj UTSW 2 90460532 missense probably damaging 0.98
R5137:Ptprj UTSW 2 90469648 missense possibly damaging 0.70
R5349:Ptprj UTSW 2 90471261 missense probably benign 0.00
R5369:Ptprj UTSW 2 90469641 missense probably benign 0.09
R5718:Ptprj UTSW 2 90458269 missense probably benign 0.00
R5914:Ptprj UTSW 2 90453340 missense possibly damaging 0.81
R6022:Ptprj UTSW 2 90471323 missense probably benign 0.14
R6341:Ptprj UTSW 2 90458349 missense probably benign
R6421:Ptprj UTSW 2 90471140 missense possibly damaging 0.62
R6724:Ptprj UTSW 2 90450851 missense probably benign 0.04
R6831:Ptprj UTSW 2 90460647 missense probably damaging 1.00
R6939:Ptprj UTSW 2 90459514 missense possibly damaging 0.68
R7134:Ptprj UTSW 2 90464478 missense probably benign 0.16
R7149:Ptprj UTSW 2 90444446 missense possibly damaging 0.95
R7243:Ptprj UTSW 2 90446421 missense probably damaging 0.96
R7335:Ptprj UTSW 2 90440782 missense probably benign 0.01
R7439:Ptprj UTSW 2 90449819 missense possibly damaging 0.82
R7441:Ptprj UTSW 2 90449819 missense possibly damaging 0.82
R7498:Ptprj UTSW 2 90436565 nonsense probably null
R7571:Ptprj UTSW 2 90455186 missense probably benign 0.24
R7657:Ptprj UTSW 2 90452157 splice site probably null
R7672:Ptprj UTSW 2 90460596 missense possibly damaging 0.49
R7849:Ptprj UTSW 2 90444460 missense probably damaging 0.98
R7939:Ptprj UTSW 2 90464665 missense probably damaging 1.00
R7958:Ptprj UTSW 2 90469627 missense possibly damaging 0.71
R8338:Ptprj UTSW 2 90471137 missense possibly damaging 0.48
RF013:Ptprj UTSW 2 90471170 nonsense probably null
Z1177:Ptprj UTSW 2 90460569 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CACTCGAGAGCTTACCTGGC -3'
(R):5'- CCATCCATACTAGCTCGTGG -3'

Sequencing Primer
(F):5'- AGAGCTTACCTGGCCCTGG -3'
(R):5'- TCCCGAGTCCCAGGAATGTG -3'
Posted On2018-11-28