Incidental Mutation 'R6972:Pltp'
ID542285
Institutional Source Beutler Lab
Gene Symbol Pltp
Ensembl Gene ENSMUSG00000017754
Gene Namephospholipid transfer protein
SynonymsBpife, OD107
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R6972 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location164839518-164857711 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 164846592 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104940 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059954] [ENSMUST00000109316] [ENSMUST00000109317]
Predicted Effect probably null
Transcript: ENSMUST00000059954
SMART Domains Protein: ENSMUSP00000061519
Gene: ENSMUSG00000017754

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
BPI1 25 243 5.93e-83 SMART
BPI2 258 460 1.35e-68 SMART
low complexity region 477 493 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000109316
SMART Domains Protein: ENSMUSP00000104939
Gene: ENSMUSG00000017754

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
BPI1 25 243 5.93e-83 SMART
BPI2 258 460 1.35e-68 SMART
low complexity region 477 493 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000109317
SMART Domains Protein: ENSMUSP00000104940
Gene: ENSMUSG00000017754

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
BPI1 25 191 1.77e-40 SMART
BPI2 206 408 1.35e-68 SMART
low complexity region 425 441 N/A INTRINSIC
Meta Mutation Damage Score 0.9590 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.0%
  • 20x: 95.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of at least two lipid transfer proteins found in human plasma. The encoded protein transfers phospholipids from triglyceride-rich lipoproteins to high density lipoprotein (HDL). In addition to regulating the size of HDL particles, this protein may be involved in cholesterol metabolism. At least two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene have lower levels of circulating HDL and exhibit symptoms of dry eye syndrome such as corneal epithelial damage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,326,109 Y218N probably damaging Het
Abhd2 A G 7: 79,354,027 S285G probably benign Het
Afg1l T C 10: 42,478,374 T10A probably benign Het
Akap9 A G 5: 4,046,699 N2525D possibly damaging Het
B3gnt7 G A 1: 86,305,387 M1I probably null Het
Bdp1 T C 13: 100,037,761 E2089G probably null Het
Calcrl T G 2: 84,368,578 I156L probably benign Het
Cd69 T C 6: 129,269,580 S122G probably benign Het
Chek2 T C 5: 110,855,839 probably null Het
Ckap5 T A 2: 91,606,313 I1586K probably damaging Het
Cyp4f14 C T 17: 32,905,509 A523T probably benign Het
Dcaf1 T A 9: 106,846,772 C466* probably null Het
Dcdc2a A T 13: 25,120,389 probably benign Het
Eml5 T C 12: 98,876,180 I220V probably benign Het
Etv2 T C 7: 30,634,742 N189D probably benign Het
Fam19a2 A G 10: 123,704,373 T45A probably benign Het
Fuz T C 7: 44,897,331 probably benign Het
Git1 T G 11: 77,499,521 V64G probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gpr162 C T 6: 124,861,309 R126H probably damaging Het
Grm5 T C 7: 87,602,923 V127A probably benign Het
Iqsec1 T C 6: 90,676,768 D665G probably damaging Het
Kcnh1 A G 1: 192,276,836 I233V probably damaging Het
Lmcd1 C T 6: 112,310,698 T115I probably damaging Het
Mybpc1 T C 10: 88,560,361 E208G possibly damaging Het
Nfic C A 10: 81,420,357 A158S probably benign Het
Nos3 A T 5: 24,380,243 I798L probably benign Het
Ntrk1 A T 3: 87,783,981 L292Q probably damaging Het
Olfr698 A G 7: 106,752,699 S230P possibly damaging Het
Orc4 T C 2: 48,927,184 Q164R probably benign Het
Pcdhb14 T A 18: 37,449,692 V617E probably damaging Het
Plscr3 G A 11: 69,847,958 E149K probably damaging Het
Pramef6 A G 4: 143,896,902 L234P probably damaging Het
Prg2 G A 2: 84,982,273 R109H probably benign Het
Ptprj G A 2: 90,580,403 S62F possibly damaging Het
Skint3 T A 4: 112,258,892 S240T probably damaging Het
Smarca5 A G 8: 80,704,751 Y946H probably damaging Het
Taf4b T C 18: 14,813,347 V409A possibly damaging Het
Trim29 T A 9: 43,327,112 N504K probably benign Het
Vmn2r77 T C 7: 86,802,994 Y461H probably damaging Het
Zeb2 T C 2: 44,997,318 K531E probably damaging Het
Zfp687 A G 3: 95,009,377 S813P possibly damaging Het
Other mutations in Pltp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02697:Pltp APN 2 164840526 missense probably benign 0.01
R0363:Pltp UTSW 2 164840136 missense probably benign 0.03
R0446:Pltp UTSW 2 164854400 missense probably damaging 1.00
R0496:Pltp UTSW 2 164852461 unclassified probably benign
R3845:Pltp UTSW 2 164854288 missense probably benign 0.08
R7365:Pltp UTSW 2 164854322 missense probably damaging 1.00
R7663:Pltp UTSW 2 164857006 splice site probably null
Predicted Primers PCR Primer
(F):5'- TTCACAGAGTGGGAGATAGACCTG -3'
(R):5'- ATGGAGAGCTACTTCCAGGC -3'

Sequencing Primer
(F):5'- TGGGAGATAGACCTGGCAAG -3'
(R):5'- TCCAGGCTGGAGCGCTG -3'
Posted On2018-11-28