Incidental Mutation 'R6972:Ntrk1'
ID542286
Institutional Source Beutler Lab
Gene Symbol Ntrk1
Ensembl Gene ENSMUSG00000028072
Gene Nameneurotrophic tyrosine kinase, receptor, type 1
SynonymsTkr, TrkA
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6972 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location87778244-87795162 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87783981 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 292 (L292Q)
Ref Sequence ENSEMBL: ENSMUSP00000029712 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029712] [ENSMUST00000029714] [ENSMUST00000090981]
Predicted Effect probably damaging
Transcript: ENSMUST00000029712
AA Change: L292Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029712
Gene: ENSMUSG00000028072
AA Change: L292Q

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:LRR_8 91 150 8.9e-14 PFAM
Pfam:TPKR_C2 151 194 4.9e-15 PFAM
IG 202 285 3.2e-2 SMART
low complexity region 419 442 N/A INTRINSIC
TyrKc 513 784 2.31e-142 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000029714
SMART Domains Protein: ENSMUSP00000029714
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090981
SMART Domains Protein: ENSMUSP00000088503
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Meta Mutation Damage Score 0.7360 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.0%
  • 20x: 95.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurotrophic tyrosine kinase receptor (NTKR) family. This kinase is a membrane-bound receptor that, upon neurotrophin binding, phosphorylates itself and members of the MAPK pathway. The presence of this kinase leads to cell differentiation and may play a role in specifying sensory neuron subtypes. Mutations in this gene have been associated with congenital insensitivity to pain, anhidrosis, self-mutilating behavior, mental retardation and cancer. Alternate transcriptional splice variants of this gene have been found, but only three have been characterized to date. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutations result in premature death due to severe sensory and sympathetic neuropathies. A conditional mutant mouse exhibits defects in mast cell and B cell physiology. Homozygotes for a point mutation are normal, but are subject to pharmacological control of signalling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,326,109 Y218N probably damaging Het
Abhd2 A G 7: 79,354,027 S285G probably benign Het
Afg1l T C 10: 42,478,374 T10A probably benign Het
Akap9 A G 5: 4,046,699 N2525D possibly damaging Het
B3gnt7 G A 1: 86,305,387 M1I probably null Het
Bdp1 T C 13: 100,037,761 E2089G probably null Het
Calcrl T G 2: 84,368,578 I156L probably benign Het
Cd69 T C 6: 129,269,580 S122G probably benign Het
Chek2 T C 5: 110,855,839 probably null Het
Ckap5 T A 2: 91,606,313 I1586K probably damaging Het
Cyp4f14 C T 17: 32,905,509 A523T probably benign Het
Dcaf1 T A 9: 106,846,772 C466* probably null Het
Dcdc2a A T 13: 25,120,389 probably benign Het
Eml5 T C 12: 98,876,180 I220V probably benign Het
Etv2 T C 7: 30,634,742 N189D probably benign Het
Fam19a2 A G 10: 123,704,373 T45A probably benign Het
Fuz T C 7: 44,897,331 probably benign Het
Git1 T G 11: 77,499,521 V64G probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gpr162 C T 6: 124,861,309 R126H probably damaging Het
Grm5 T C 7: 87,602,923 V127A probably benign Het
Iqsec1 T C 6: 90,676,768 D665G probably damaging Het
Kcnh1 A G 1: 192,276,836 I233V probably damaging Het
Lmcd1 C T 6: 112,310,698 T115I probably damaging Het
Mybpc1 T C 10: 88,560,361 E208G possibly damaging Het
Nfic C A 10: 81,420,357 A158S probably benign Het
Nos3 A T 5: 24,380,243 I798L probably benign Het
Olfr698 A G 7: 106,752,699 S230P possibly damaging Het
Orc4 T C 2: 48,927,184 Q164R probably benign Het
Pcdhb14 T A 18: 37,449,692 V617E probably damaging Het
Plscr3 G A 11: 69,847,958 E149K probably damaging Het
Pltp A G 2: 164,846,592 probably null Het
Pramef6 A G 4: 143,896,902 L234P probably damaging Het
Prg2 G A 2: 84,982,273 R109H probably benign Het
Ptprj G A 2: 90,580,403 S62F possibly damaging Het
Skint3 T A 4: 112,258,892 S240T probably damaging Het
Smarca5 A G 8: 80,704,751 Y946H probably damaging Het
Taf4b T C 18: 14,813,347 V409A possibly damaging Het
Trim29 T A 9: 43,327,112 N504K probably benign Het
Vmn2r77 T C 7: 86,802,994 Y461H probably damaging Het
Zeb2 T C 2: 44,997,318 K531E probably damaging Het
Zfp687 A G 3: 95,009,377 S813P possibly damaging Het
Other mutations in Ntrk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Ntrk1 APN 3 87791438 missense possibly damaging 0.94
IGL00756:Ntrk1 APN 3 87783697 missense probably benign 0.05
IGL01340:Ntrk1 APN 3 87788714 missense possibly damaging 0.72
IGL02262:Ntrk1 APN 3 87781797 missense probably damaging 1.00
IGL02268:Ntrk1 APN 3 87781531 missense probably damaging 1.00
IGL02290:Ntrk1 APN 3 87781771 missense probably benign 0.11
IGL02435:Ntrk1 APN 3 87788732 missense probably benign 0.01
IGL03007:Ntrk1 APN 3 87782743 missense possibly damaging 0.56
PIT4802001:Ntrk1 UTSW 3 87788634 missense probably damaging 0.98
R0015:Ntrk1 UTSW 3 87791750 intron probably benign
R0140:Ntrk1 UTSW 3 87778568 missense probably damaging 1.00
R0269:Ntrk1 UTSW 3 87783933 missense possibly damaging 0.78
R0457:Ntrk1 UTSW 3 87791707 missense probably benign
R0617:Ntrk1 UTSW 3 87783933 missense possibly damaging 0.78
R1144:Ntrk1 UTSW 3 87781542 missense probably damaging 1.00
R1152:Ntrk1 UTSW 3 87778593 missense probably benign 0.33
R1439:Ntrk1 UTSW 3 87789611 splice site probably null
R1588:Ntrk1 UTSW 3 87780077 nonsense probably null
R1764:Ntrk1 UTSW 3 87780084 missense probably damaging 0.99
R1766:Ntrk1 UTSW 3 87778518 missense probably damaging 1.00
R1771:Ntrk1 UTSW 3 87789630 missense probably benign
R2264:Ntrk1 UTSW 3 87779634 critical splice donor site probably null
R2377:Ntrk1 UTSW 3 87791407 missense possibly damaging 0.70
R4059:Ntrk1 UTSW 3 87781479 missense probably damaging 1.00
R4950:Ntrk1 UTSW 3 87789611 splice site probably null
R5107:Ntrk1 UTSW 3 87794973 missense probably benign 0.01
R5805:Ntrk1 UTSW 3 87780172 missense probably damaging 1.00
R6073:Ntrk1 UTSW 3 87791370 splice site probably null
R6372:Ntrk1 UTSW 3 87786048 missense probably benign
R6894:Ntrk1 UTSW 3 87782802 missense probably damaging 1.00
R6973:Ntrk1 UTSW 3 87783981 missense probably damaging 1.00
R7309:Ntrk1 UTSW 3 87795077 missense probably benign 0.00
R7693:Ntrk1 UTSW 3 87788426 missense probably benign
R7836:Ntrk1 UTSW 3 87779734 nonsense probably null
R8311:Ntrk1 UTSW 3 87781563 missense probably damaging 1.00
R8458:Ntrk1 UTSW 3 87791669 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACATGCGTGGGCTGATTGAG -3'
(R):5'- TGACCCTTAAGCCTCAGATTTTG -3'

Sequencing Primer
(F):5'- GCTGATTGAGGCGCAGG -3'
(R):5'- CGTTTTCTGCCATATTCAGTATCG -3'
Posted On2018-11-28