Incidental Mutation 'R6972:Pramef6'
ID542289
Institutional Source Beutler Lab
Gene Symbol Pramef6
Ensembl Gene ENSMUSG00000078512
Gene NamePRAME family member 6
SynonymsGm13099
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R6972 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location143894237-143900380 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 143896902 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 234 (L234P)
Ref Sequence ENSEMBL: ENSMUSP00000080350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081645] [ENSMUST00000105767]
Predicted Effect probably damaging
Transcript: ENSMUST00000081645
AA Change: L234P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080350
Gene: ENSMUSG00000078512
AA Change: L234P

DomainStartEndE-ValueType
SCOP:d1a4ya_ 204 412 6e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105767
AA Change: L234P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000101393
Gene: ENSMUSG00000078512
AA Change: L234P

DomainStartEndE-ValueType
SCOP:d1a4ya_ 204 412 1e-11 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.0%
  • 20x: 95.8%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,326,109 Y218N probably damaging Het
Abhd2 A G 7: 79,354,027 S285G probably benign Het
Afg1l T C 10: 42,478,374 T10A probably benign Het
Akap9 A G 5: 4,046,699 N2525D possibly damaging Het
B3gnt7 G A 1: 86,305,387 M1I probably null Het
Bdp1 T C 13: 100,037,761 E2089G probably null Het
Calcrl T G 2: 84,368,578 I156L probably benign Het
Cd69 T C 6: 129,269,580 S122G probably benign Het
Chek2 T C 5: 110,855,839 probably null Het
Ckap5 T A 2: 91,606,313 I1586K probably damaging Het
Cyp4f14 C T 17: 32,905,509 A523T probably benign Het
Dcaf1 T A 9: 106,846,772 C466* probably null Het
Dcdc2a A T 13: 25,120,389 probably benign Het
Eml5 T C 12: 98,876,180 I220V probably benign Het
Etv2 T C 7: 30,634,742 N189D probably benign Het
Fam19a2 A G 10: 123,704,373 T45A probably benign Het
Fuz T C 7: 44,897,331 probably benign Het
Git1 T G 11: 77,499,521 V64G probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gpr162 C T 6: 124,861,309 R126H probably damaging Het
Grm5 T C 7: 87,602,923 V127A probably benign Het
Iqsec1 T C 6: 90,676,768 D665G probably damaging Het
Kcnh1 A G 1: 192,276,836 I233V probably damaging Het
Lmcd1 C T 6: 112,310,698 T115I probably damaging Het
Mybpc1 T C 10: 88,560,361 E208G possibly damaging Het
Nfic C A 10: 81,420,357 A158S probably benign Het
Nos3 A T 5: 24,380,243 I798L probably benign Het
Ntrk1 A T 3: 87,783,981 L292Q probably damaging Het
Olfr698 A G 7: 106,752,699 S230P possibly damaging Het
Orc4 T C 2: 48,927,184 Q164R probably benign Het
Pcdhb14 T A 18: 37,449,692 V617E probably damaging Het
Plscr3 G A 11: 69,847,958 E149K probably damaging Het
Pltp A G 2: 164,846,592 probably null Het
Prg2 G A 2: 84,982,273 R109H probably benign Het
Ptprj G A 2: 90,580,403 S62F possibly damaging Het
Skint3 T A 4: 112,258,892 S240T probably damaging Het
Smarca5 A G 8: 80,704,751 Y946H probably damaging Het
Taf4b T C 18: 14,813,347 V409A possibly damaging Het
Trim29 T A 9: 43,327,112 N504K probably benign Het
Vmn2r77 T C 7: 86,802,994 Y461H probably damaging Het
Zeb2 T C 2: 44,997,318 K531E probably damaging Het
Zfp687 A G 3: 95,009,377 S813P possibly damaging Het
Other mutations in Pramef6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01704:Pramef6 APN 4 143895631 missense probably benign
IGL01917:Pramef6 APN 4 143897714 missense probably benign 0.15
IGL02222:Pramef6 APN 4 143895846 missense possibly damaging 0.94
IGL02315:Pramef6 APN 4 143897928 start gained probably benign
R0488:Pramef6 UTSW 4 143895403 missense probably benign 0.00
R0755:Pramef6 UTSW 4 143897729 missense probably damaging 0.96
R0972:Pramef6 UTSW 4 143896963 missense probably benign 0.02
R1444:Pramef6 UTSW 4 143896891 missense probably benign 0.01
R1551:Pramef6 UTSW 4 143895693 missense probably benign 0.00
R1907:Pramef6 UTSW 4 143895491 missense possibly damaging 0.89
R2068:Pramef6 UTSW 4 143896912 missense probably damaging 1.00
R2182:Pramef6 UTSW 4 143897190 missense possibly damaging 0.60
R2246:Pramef6 UTSW 4 143897220 missense probably benign 0.19
R4483:Pramef6 UTSW 4 143895840 missense probably damaging 1.00
R5123:Pramef6 UTSW 4 143897136 missense probably benign 0.00
R5291:Pramef6 UTSW 4 143895667 missense probably damaging 1.00
R5643:Pramef6 UTSW 4 143895767 missense probably damaging 0.98
R5683:Pramef6 UTSW 4 143895853 missense probably damaging 1.00
R5836:Pramef6 UTSW 4 143896920 missense probably benign 0.30
R5837:Pramef6 UTSW 4 143896920 missense probably benign 0.30
R5838:Pramef6 UTSW 4 143896920 missense probably benign 0.30
R5853:Pramef6 UTSW 4 143896920 missense probably benign 0.30
R6340:Pramef6 UTSW 4 143897307 missense possibly damaging 0.69
R6572:Pramef6 UTSW 4 143895373 missense possibly damaging 0.79
R6791:Pramef6 UTSW 4 143895682 missense probably benign 0.02
R7265:Pramef6 UTSW 4 143895421 missense probably benign 0.00
R7307:Pramef6 UTSW 4 143896775 nonsense probably null
R7342:Pramef6 UTSW 4 143896950 missense probably benign 0.26
R7361:Pramef6 UTSW 4 143895886 missense possibly damaging 0.88
R7480:Pramef6 UTSW 4 143895495 missense probably benign
R7685:Pramef6 UTSW 4 143897801 missense probably benign 0.28
R7861:Pramef6 UTSW 4 143897718 missense possibly damaging 0.75
Z1176:Pramef6 UTSW 4 143895684 missense probably damaging 1.00
Z1177:Pramef6 UTSW 4 143897199 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- TGCTCACCCTTGGATAAAGC -3'
(R):5'- ATTTGTATCGGTGGGCCAAG -3'

Sequencing Primer
(F):5'- TTCTTACCTGAGCATTTGGTCCAGG -3'
(R):5'- TATCGGTGGGCCAAGGAGAG -3'
Posted On2018-11-28