Incidental Mutation 'R6972:Chek2'
ID542292
Institutional Source Beutler Lab
Gene Symbol Chek2
Ensembl Gene ENSMUSG00000029521
Gene Namecheckpoint kinase 2
SynonymsRad53, CHK2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6972 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location110839979-110874145 bp(+) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) T to C at 110855839 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000066679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066160] [ENSMUST00000199937]
Predicted Effect probably null
Transcript: ENSMUST00000066160
SMART Domains Protein: ENSMUSP00000066679
Gene: ENSMUSG00000029521

DomainStartEndE-ValueType
low complexity region 2 37 N/A INTRINSIC
low complexity region 41 72 N/A INTRINSIC
FHA 116 179 5.14e-3 SMART
S_TKc 224 490 7.35e-104 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199937
SMART Domains Protein: ENSMUSP00000143558
Gene: ENSMUSG00000029521

DomainStartEndE-ValueType
low complexity region 2 37 N/A INTRINSIC
low complexity region 41 72 N/A INTRINSIC
FHA 116 179 2.6e-5 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.0%
  • 20x: 95.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In response to DNA damage and replication blocks, cell cycle progression is halted through the control of critical cell cycle regulators. The protein encoded by this gene is a cell cycle checkpoint regulator and putative tumor suppressor. It contains a forkhead-associated protein interaction domain essential for activation in response to DNA damage and is rapidly phosphorylated in response to replication blocks and DNA damage. When activated, the encoded protein is known to inhibit CDC25C phosphatase, preventing entry into mitosis, and has been shown to stabilize the tumor suppressor protein p53, leading to cell cycle arrest in G1. In addition, this protein interacts with and phosphorylates BRCA1, allowing BRCA1 to restore survival after DNA damage. Mutations in this gene have been linked with Li-Fraumeni syndrome, a highly penetrant familial cancer phenotype usually associated with inherited mutations in TP53. Also, mutations in this gene are thought to confer a predisposition to sarcomas, breast cancer, and brain tumors. This nuclear protein is a member of the CDS1 subfamily of serine/threonine protein kinases. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Homozygous mutation of this gene does not increase tumor incidence. Cells from the thymus, central nervous system (CNS), hair follicles, and skin are resistant to ionizing radiation- and gamma irradiation-induced apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,326,109 Y218N probably damaging Het
Abhd2 A G 7: 79,354,027 S285G probably benign Het
Afg1l T C 10: 42,478,374 T10A probably benign Het
Akap9 A G 5: 4,046,699 N2525D possibly damaging Het
B3gnt7 G A 1: 86,305,387 M1I probably null Het
Bdp1 T C 13: 100,037,761 E2089G probably null Het
Calcrl T G 2: 84,368,578 I156L probably benign Het
Cd69 T C 6: 129,269,580 S122G probably benign Het
Ckap5 T A 2: 91,606,313 I1586K probably damaging Het
Cyp4f14 C T 17: 32,905,509 A523T probably benign Het
Dcaf1 T A 9: 106,846,772 C466* probably null Het
Dcdc2a A T 13: 25,120,389 probably benign Het
Eml5 T C 12: 98,876,180 I220V probably benign Het
Etv2 T C 7: 30,634,742 N189D probably benign Het
Fam19a2 A G 10: 123,704,373 T45A probably benign Het
Fuz T C 7: 44,897,331 probably benign Het
Git1 T G 11: 77,499,521 V64G probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gpr162 C T 6: 124,861,309 R126H probably damaging Het
Grm5 T C 7: 87,602,923 V127A probably benign Het
Iqsec1 T C 6: 90,676,768 D665G probably damaging Het
Kcnh1 A G 1: 192,276,836 I233V probably damaging Het
Lmcd1 C T 6: 112,310,698 T115I probably damaging Het
Mybpc1 T C 10: 88,560,361 E208G possibly damaging Het
Nfic C A 10: 81,420,357 A158S probably benign Het
Nos3 A T 5: 24,380,243 I798L probably benign Het
Ntrk1 A T 3: 87,783,981 L292Q probably damaging Het
Olfr698 A G 7: 106,752,699 S230P possibly damaging Het
Orc4 T C 2: 48,927,184 Q164R probably benign Het
Pcdhb14 T A 18: 37,449,692 V617E probably damaging Het
Plscr3 G A 11: 69,847,958 E149K probably damaging Het
Pltp A G 2: 164,846,592 probably null Het
Pramef6 A G 4: 143,896,902 L234P probably damaging Het
Prg2 G A 2: 84,982,273 R109H probably benign Het
Ptprj G A 2: 90,580,403 S62F possibly damaging Het
Skint3 T A 4: 112,258,892 S240T probably damaging Het
Smarca5 A G 8: 80,704,751 Y946H probably damaging Het
Taf4b T C 18: 14,813,347 V409A possibly damaging Het
Trim29 T A 9: 43,327,112 N504K probably benign Het
Vmn2r77 T C 7: 86,802,994 Y461H probably damaging Het
Zeb2 T C 2: 44,997,318 K531E probably damaging Het
Zfp687 A G 3: 95,009,377 S813P possibly damaging Het
Other mutations in Chek2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01025:Chek2 APN 5 110848670 missense probably damaging 1.00
IGL01830:Chek2 APN 5 110873508 missense probably benign
IGL01943:Chek2 APN 5 110841227 unclassified probably benign
IGL02319:Chek2 APN 5 110867011 missense possibly damaging 0.88
IGL03147:Chek2 UTSW 5 110848670 missense probably damaging 1.00
PIT4520001:Chek2 UTSW 5 110863329 missense probably damaging 1.00
R1484:Chek2 UTSW 5 110848687 missense probably damaging 1.00
R1486:Chek2 UTSW 5 110841227 unclassified probably benign
R1732:Chek2 UTSW 5 110872102 missense probably benign 0.26
R2041:Chek2 UTSW 5 110848664 missense probably damaging 1.00
R2071:Chek2 UTSW 5 110841246 unclassified probably benign
R2873:Chek2 UTSW 5 110863336 nonsense probably null
R2935:Chek2 UTSW 5 110868020 missense probably damaging 1.00
R3899:Chek2 UTSW 5 110865613 splice site probably benign
R4662:Chek2 UTSW 5 110867042 missense probably damaging 1.00
R4748:Chek2 UTSW 5 110855839 splice site probably null
R5358:Chek2 UTSW 5 110841282 unclassified probably benign
R5582:Chek2 UTSW 5 110868035 missense probably damaging 0.96
R5594:Chek2 UTSW 5 110855834 critical splice donor site probably null
R6526:Chek2 UTSW 5 110848690 missense probably damaging 1.00
R7232:Chek2 UTSW 5 110860915 missense probably damaging 1.00
R7338:Chek2 UTSW 5 110873514 missense probably benign
R7395:Chek2 UTSW 5 110872108 critical splice donor site probably null
R7714:Chek2 UTSW 5 110841453 missense probably benign 0.10
R7743:Chek2 UTSW 5 110840050 critical splice donor site probably null
R8290:Chek2 UTSW 5 110860900 missense possibly damaging 0.70
R8297:Chek2 UTSW 5 110848436 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTATCAAGGCCGAGTTTGAC -3'
(R):5'- TGCACAGGGTTACATACAACC -3'

Sequencing Primer
(F):5'- CAAGGCCGAGTTTGACATGGTATG -3'
(R):5'- GTTCAGTGCTGTTTGACAG -3'
Posted On2018-11-28