Incidental Mutation 'R6972:Gpr162'
ID542294
Institutional Source Beutler Lab
Gene Symbol Gpr162
Ensembl Gene ENSMUSG00000038390
Gene NameG protein-coupled receptor 162
SynonymsA-2, Grca
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R6972 (G1)
Quality Score180.009
Status Validated
Chromosome6
Chromosomal Location124858444-124863983 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 124861309 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 126 (R126H)
Ref Sequence ENSEMBL: ENSMUSP00000145267 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023958] [ENSMUST00000024044] [ENSMUST00000046893] [ENSMUST00000135127] [ENSMUST00000204667]
Predicted Effect probably benign
Transcript: ENSMUST00000023958
SMART Domains Protein: ENSMUSP00000023958
Gene: ENSMUSG00000023191

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 58 76 N/A INTRINSIC
low complexity region 127 142 N/A INTRINSIC
low complexity region 222 242 N/A INTRINSIC
low complexity region 256 277 N/A INTRINSIC
P4Hc 460 670 8.51e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000024044
SMART Domains Protein: ENSMUSP00000024044
Gene: ENSMUSG00000023274

DomainStartEndE-ValueType
low complexity region 6 21 N/A INTRINSIC
IGv 37 114 7.02e-8 SMART
IG 131 206 3.63e-1 SMART
IG 212 317 3.36e0 SMART
transmembrane domain 394 416 N/A INTRINSIC
Pfam:Tcell_CD4_C 425 452 2.2e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000046893
AA Change: R126H

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000038536
Gene: ENSMUSG00000038390
AA Change: R126H

DomainStartEndE-ValueType
Pfam:7tm_1 30 337 1.1e-19 PFAM
low complexity region 348 362 N/A INTRINSIC
low complexity region 462 477 N/A INTRINSIC
low complexity region 482 504 N/A INTRINSIC
low complexity region 513 540 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135127
SMART Domains Protein: ENSMUSP00000116338
Gene: ENSMUSG00000023191

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 58 76 N/A INTRINSIC
low complexity region 127 142 N/A INTRINSIC
low complexity region 222 242 N/A INTRINSIC
low complexity region 256 277 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000204667
AA Change: R126H

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000145267
Gene: ENSMUSG00000038390
AA Change: R126H

DomainStartEndE-ValueType
Pfam:7tm_1 30 337 1.1e-19 PFAM
low complexity region 348 362 N/A INTRINSIC
low complexity region 462 477 N/A INTRINSIC
low complexity region 482 504 N/A INTRINSIC
low complexity region 513 540 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.0%
  • 20x: 95.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified upon genomic analysis of a gene-dense region at human chromosome 12p13. It appears to be mainly expressed in the brain; however, its function is not known. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,326,109 Y218N probably damaging Het
Abhd2 A G 7: 79,354,027 S285G probably benign Het
Afg1l T C 10: 42,478,374 T10A probably benign Het
Akap9 A G 5: 4,046,699 N2525D possibly damaging Het
B3gnt7 G A 1: 86,305,387 M1I probably null Het
Bdp1 T C 13: 100,037,761 E2089G probably null Het
Calcrl T G 2: 84,368,578 I156L probably benign Het
Cd69 T C 6: 129,269,580 S122G probably benign Het
Chek2 T C 5: 110,855,839 probably null Het
Ckap5 T A 2: 91,606,313 I1586K probably damaging Het
Cyp4f14 C T 17: 32,905,509 A523T probably benign Het
Dcaf1 T A 9: 106,846,772 C466* probably null Het
Dcdc2a A T 13: 25,120,389 probably benign Het
Eml5 T C 12: 98,876,180 I220V probably benign Het
Etv2 T C 7: 30,634,742 N189D probably benign Het
Fam19a2 A G 10: 123,704,373 T45A probably benign Het
Fuz T C 7: 44,897,331 probably benign Het
Git1 T G 11: 77,499,521 V64G probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Grm5 T C 7: 87,602,923 V127A probably benign Het
Iqsec1 T C 6: 90,676,768 D665G probably damaging Het
Kcnh1 A G 1: 192,276,836 I233V probably damaging Het
Lmcd1 C T 6: 112,310,698 T115I probably damaging Het
Mybpc1 T C 10: 88,560,361 E208G possibly damaging Het
Nfic C A 10: 81,420,357 A158S probably benign Het
Nos3 A T 5: 24,380,243 I798L probably benign Het
Ntrk1 A T 3: 87,783,981 L292Q probably damaging Het
Olfr698 A G 7: 106,752,699 S230P possibly damaging Het
Orc4 T C 2: 48,927,184 Q164R probably benign Het
Pcdhb14 T A 18: 37,449,692 V617E probably damaging Het
Plscr3 G A 11: 69,847,958 E149K probably damaging Het
Pltp A G 2: 164,846,592 probably null Het
Pramef6 A G 4: 143,896,902 L234P probably damaging Het
Prg2 G A 2: 84,982,273 R109H probably benign Het
Ptprj G A 2: 90,580,403 S62F possibly damaging Het
Skint3 T A 4: 112,258,892 S240T probably damaging Het
Smarca5 A G 8: 80,704,751 Y946H probably damaging Het
Taf4b T C 18: 14,813,347 V409A possibly damaging Het
Trim29 T A 9: 43,327,112 N504K probably benign Het
Vmn2r77 T C 7: 86,802,994 Y461H probably damaging Het
Zeb2 T C 2: 44,997,318 K531E probably damaging Het
Zfp687 A G 3: 95,009,377 S813P possibly damaging Het
Other mutations in Gpr162
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01134:Gpr162 APN 6 124858857 splice site probably null
IGL01879:Gpr162 APN 6 124861241 missense probably damaging 1.00
IGL01901:Gpr162 APN 6 124861407 missense possibly damaging 0.95
IGL01930:Gpr162 APN 6 124861612 missense possibly damaging 0.82
IGL02334:Gpr162 APN 6 124861160 missense probably damaging 1.00
R1036:Gpr162 UTSW 6 124860860 missense probably damaging 0.99
R1322:Gpr162 UTSW 6 124858901 missense probably damaging 0.96
R1351:Gpr162 UTSW 6 124861198 missense probably damaging 1.00
R1549:Gpr162 UTSW 6 124860088 missense probably damaging 1.00
R1933:Gpr162 UTSW 6 124861447 missense probably damaging 0.98
R4214:Gpr162 UTSW 6 124860068 missense probably damaging 1.00
R4367:Gpr162 UTSW 6 124861695 start gained probably benign
R4628:Gpr162 UTSW 6 124861442 missense probably benign 0.03
R5290:Gpr162 UTSW 6 124861269 missense probably benign 0.17
R5354:Gpr162 UTSW 6 124859637 missense probably benign 0.06
R5404:Gpr162 UTSW 6 124861643 missense possibly damaging 0.73
R5465:Gpr162 UTSW 6 124861171 missense probably damaging 1.00
R5520:Gpr162 UTSW 6 124860913 missense probably damaging 1.00
R5566:Gpr162 UTSW 6 124860938 nonsense probably null
R6184:Gpr162 UTSW 6 124861241 missense probably damaging 1.00
R6450:Gpr162 UTSW 6 124861189 missense possibly damaging 0.84
R6685:Gpr162 UTSW 6 124861531 missense probably damaging 1.00
R6807:Gpr162 UTSW 6 124861201 missense probably damaging 0.97
R6982:Gpr162 UTSW 6 124860956 missense probably damaging 1.00
R7543:Gpr162 UTSW 6 124861392 nonsense probably null
R7650:Gpr162 UTSW 6 124861843 start gained probably benign
Predicted Primers PCR Primer
(F):5'- GCCCACAGTGTCTGATAGAATG -3'
(R):5'- TATACTCATGGCGGCTGTGC -3'

Sequencing Primer
(F):5'- GTGTCTGATAGAATGTGATAGCCAC -3'
(R):5'- GGCTGTGCCCCTTACCAC -3'
Posted On2018-11-28