Incidental Mutation 'R6972:Cd69'
ID542295
Institutional Source Beutler Lab
Gene Symbol Cd69
Ensembl Gene ENSMUSG00000030156
Gene NameCD69 antigen
SynonymsVEA, AIM, 5830438K24Rik
MMRRC Submission
Accession Numbers

Genbank: NM_001033122; MGI: 88343

Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R6972 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location129267325-129275436 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 129269580 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 122 (S122G)
Ref Sequence ENSEMBL: ENSMUSP00000144734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032259] [ENSMUST00000204411]
Predicted Effect probably benign
Transcript: ENSMUST00000032259
AA Change: S163G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000032259
Gene: ENSMUSG00000030156
AA Change: S163G

DomainStartEndE-ValueType
Blast:CLECT 3 42 3e-8 BLAST
low complexity region 44 61 N/A INTRINSIC
CLECT 85 195 3e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204411
AA Change: S122G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000144734
Gene: ENSMUSG00000030156
AA Change: S122G

DomainStartEndE-ValueType
CLECT 44 154 1.5e-25 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.0%
  • 20x: 95.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calcium dependent lectin superfamily of type II transmembrane receptors. Expression of the encoded protein is induced upon activation of T lymphocytes, and may play a role in proliferation. Furthermore, the protein may act to transmit signals in natural killer cells and platelets. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous mutation of this gene results in slightly increased pre-B and immature B cell numbers in the bone marrow, and increased IgG2a and IgM response to T cell-dependent and T cell-independent antigens. Mutant mice were less prone to collagen inducedarthritis. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(2)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,326,109 Y218N probably damaging Het
Abhd2 A G 7: 79,354,027 S285G probably benign Het
Afg1l T C 10: 42,478,374 T10A probably benign Het
Akap9 A G 5: 4,046,699 N2525D possibly damaging Het
B3gnt7 G A 1: 86,305,387 M1I probably null Het
Bdp1 T C 13: 100,037,761 E2089G probably null Het
Calcrl T G 2: 84,368,578 I156L probably benign Het
Chek2 T C 5: 110,855,839 probably null Het
Ckap5 T A 2: 91,606,313 I1586K probably damaging Het
Cyp4f14 C T 17: 32,905,509 A523T probably benign Het
Dcaf1 T A 9: 106,846,772 C466* probably null Het
Dcdc2a A T 13: 25,120,389 probably benign Het
Eml5 T C 12: 98,876,180 I220V probably benign Het
Etv2 T C 7: 30,634,742 N189D probably benign Het
Fam19a2 A G 10: 123,704,373 T45A probably benign Het
Fuz T C 7: 44,897,331 probably benign Het
Git1 T G 11: 77,499,521 V64G probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gpr162 C T 6: 124,861,309 R126H probably damaging Het
Grm5 T C 7: 87,602,923 V127A probably benign Het
Iqsec1 T C 6: 90,676,768 D665G probably damaging Het
Kcnh1 A G 1: 192,276,836 I233V probably damaging Het
Lmcd1 C T 6: 112,310,698 T115I probably damaging Het
Mybpc1 T C 10: 88,560,361 E208G possibly damaging Het
Nfic C A 10: 81,420,357 A158S probably benign Het
Nos3 A T 5: 24,380,243 I798L probably benign Het
Ntrk1 A T 3: 87,783,981 L292Q probably damaging Het
Olfr698 A G 7: 106,752,699 S230P possibly damaging Het
Orc4 T C 2: 48,927,184 Q164R probably benign Het
Pcdhb14 T A 18: 37,449,692 V617E probably damaging Het
Plscr3 G A 11: 69,847,958 E149K probably damaging Het
Pltp A G 2: 164,846,592 probably null Het
Pramef6 A G 4: 143,896,902 L234P probably damaging Het
Prg2 G A 2: 84,982,273 R109H probably benign Het
Ptprj G A 2: 90,580,403 S62F possibly damaging Het
Skint3 T A 4: 112,258,892 S240T probably damaging Het
Smarca5 A G 8: 80,704,751 Y946H probably damaging Het
Taf4b T C 18: 14,813,347 V409A possibly damaging Het
Trim29 T A 9: 43,327,112 N504K probably benign Het
Vmn2r77 T C 7: 86,802,994 Y461H probably damaging Het
Zeb2 T C 2: 44,997,318 K531E probably damaging Het
Zfp687 A G 3: 95,009,377 S813P possibly damaging Het
Other mutations in Cd69
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00573:Cd69 APN 6 129268320 missense probably damaging 1.00
IGL02799:Cd69 APN 6 129268260 splice site probably benign
Jazzed UTSW 6 129269574 critical splice donor site probably null
Surrogate UTSW 6 129269580 missense probably benign 0.00
3-1:Cd69 UTSW 6 129275249 missense probably damaging 0.99
R0119:Cd69 UTSW 6 129270062 missense probably benign 0.01
R0136:Cd69 UTSW 6 129270062 missense probably benign 0.01
R1185:Cd69 UTSW 6 129270185 missense probably damaging 1.00
R1185:Cd69 UTSW 6 129270185 missense probably damaging 1.00
R1185:Cd69 UTSW 6 129270185 missense probably damaging 1.00
R2327:Cd69 UTSW 6 129271388 missense probably damaging 1.00
R2352:Cd69 UTSW 6 129269604 missense probably damaging 1.00
R3955:Cd69 UTSW 6 129268380 splice site probably null
R4780:Cd69 UTSW 6 129271355 missense probably damaging 1.00
R5400:Cd69 UTSW 6 129269991 missense probably benign 0.01
R5522:Cd69 UTSW 6 129271416 missense probably damaging 0.97
R6594:Cd69 UTSW 6 129269574 critical splice donor site probably null
R6737:Cd69 UTSW 6 129268299 missense probably benign 0.04
R7240:Cd69 UTSW 6 129270042 missense possibly damaging 0.78
R7694:Cd69 UTSW 6 129270045 missense possibly damaging 0.91
Z1176:Cd69 UTSW 6 129268342 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTGAGGAAGAACTGAACCACC -3'
(R):5'- GCTGTATAGTCTCCCAGTGTGG -3'

Sequencing Primer
(F):5'- GAGGAAGAACTGAACCACCATGAAC -3'
(R):5'- ATGAGCTGATGCCATGCAC -3'
Posted On2018-11-28