Incidental Mutation 'R6972:Etv2'
ID542298
Institutional Source Beutler Lab
Gene Symbol Etv2
Ensembl Gene ENSMUSG00000006311
Gene Nameets variant 2
SynonymsEtsrp71
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6972 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location30633616-30635852 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30634742 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 189 (N189D)
Ref Sequence ENSEMBL: ENSMUSP00000103782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108147]
Predicted Effect probably benign
Transcript: ENSMUST00000108147
AA Change: N189D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000103782
Gene: ENSMUSG00000006311
AA Change: N189D

DomainStartEndE-ValueType
low complexity region 102 114 N/A INTRINSIC
ETS 233 318 4.77e-51 SMART
Meta Mutation Damage Score 0.1229 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.0%
  • 20x: 95.8%
Validation Efficiency 100% (41/41)
MGI Phenotype PHENOTYPE: Mice homozygous for null alleles die during organogenesis and lack blood vessels. In addition, mice homozygous for one allele lack endocardial cells, while mice homozygous for another allele lack blood cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,326,109 Y218N probably damaging Het
Abhd2 A G 7: 79,354,027 S285G probably benign Het
Afg1l T C 10: 42,478,374 T10A probably benign Het
Akap9 A G 5: 4,046,699 N2525D possibly damaging Het
B3gnt7 G A 1: 86,305,387 M1I probably null Het
Bdp1 T C 13: 100,037,761 E2089G probably null Het
Calcrl T G 2: 84,368,578 I156L probably benign Het
Cd69 T C 6: 129,269,580 S122G probably benign Het
Chek2 T C 5: 110,855,839 probably null Het
Ckap5 T A 2: 91,606,313 I1586K probably damaging Het
Cyp4f14 C T 17: 32,905,509 A523T probably benign Het
Dcaf1 T A 9: 106,846,772 C466* probably null Het
Dcdc2a A T 13: 25,120,389 probably benign Het
Eml5 T C 12: 98,876,180 I220V probably benign Het
Fam19a2 A G 10: 123,704,373 T45A probably benign Het
Fuz T C 7: 44,897,331 probably benign Het
Git1 T G 11: 77,499,521 V64G probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gpr162 C T 6: 124,861,309 R126H probably damaging Het
Grm5 T C 7: 87,602,923 V127A probably benign Het
Iqsec1 T C 6: 90,676,768 D665G probably damaging Het
Kcnh1 A G 1: 192,276,836 I233V probably damaging Het
Lmcd1 C T 6: 112,310,698 T115I probably damaging Het
Mybpc1 T C 10: 88,560,361 E208G possibly damaging Het
Nfic C A 10: 81,420,357 A158S probably benign Het
Nos3 A T 5: 24,380,243 I798L probably benign Het
Ntrk1 A T 3: 87,783,981 L292Q probably damaging Het
Olfr698 A G 7: 106,752,699 S230P possibly damaging Het
Orc4 T C 2: 48,927,184 Q164R probably benign Het
Pcdhb14 T A 18: 37,449,692 V617E probably damaging Het
Plscr3 G A 11: 69,847,958 E149K probably damaging Het
Pltp A G 2: 164,846,592 probably null Het
Pramef6 A G 4: 143,896,902 L234P probably damaging Het
Prg2 G A 2: 84,982,273 R109H probably benign Het
Ptprj G A 2: 90,580,403 S62F possibly damaging Het
Skint3 T A 4: 112,258,892 S240T probably damaging Het
Smarca5 A G 8: 80,704,751 Y946H probably damaging Het
Taf4b T C 18: 14,813,347 V409A possibly damaging Het
Trim29 T A 9: 43,327,112 N504K probably benign Het
Vmn2r77 T C 7: 86,802,994 Y461H probably damaging Het
Zeb2 T C 2: 44,997,318 K531E probably damaging Het
Zfp687 A G 3: 95,009,377 S813P possibly damaging Het
Other mutations in Etv2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Etv2 APN 7 30633667 missense probably benign 0.13
R0144:Etv2 UTSW 7 30634883 missense probably benign 0.13
R0416:Etv2 UTSW 7 30634633 missense probably benign 0.01
R6216:Etv2 UTSW 7 30634611 critical splice donor site probably null
R6812:Etv2 UTSW 7 30634001 nonsense probably null
R6973:Etv2 UTSW 7 30634742 missense probably benign 0.00
R7180:Etv2 UTSW 7 30635649 missense probably damaging 1.00
R7236:Etv2 UTSW 7 30635030 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TATCCAGGCCCAGTCCTAATC -3'
(R):5'- TTAAGGTCTGTCTTCCTCGCAG -3'

Sequencing Primer
(F):5'- AGGCCCAGTCCTAATCCGTTTTG -3'
(R):5'- TGTGCTTCACAGACGCCAG -3'
Posted On2018-11-28