Incidental Mutation 'R6972:Fuz'
ID542299
Institutional Source Beutler Lab
Gene Symbol Fuz
Ensembl Gene ENSMUSG00000011658
Gene Namefuzzy planar cell polarity protein
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.239) question?
Stock #R6972 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location44896079-44902631 bp(+) (GRCm38)
Type of Mutationcritical splice donor site
DNA Base Change (assembly) T to C at 44897331 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146434 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003049] [ENSMUST00000071207] [ENSMUST00000085399] [ENSMUST00000107857] [ENSMUST00000166972] [ENSMUST00000167930] [ENSMUST00000207069] [ENSMUST00000207154] [ENSMUST00000207278] [ENSMUST00000207485] [ENSMUST00000207654] [ENSMUST00000207788] [ENSMUST00000209163] [ENSMUST00000207939] [ENSMUST00000208179] [ENSMUST00000208253] [ENSMUST00000208551] [ENSMUST00000208556] [ENSMUST00000208600] [ENSMUST00000209039] [ENSMUST00000209132]
Predicted Effect probably benign
Transcript: ENSMUST00000003049
SMART Domains Protein: ENSMUSP00000003049
Gene: ENSMUSG00000002968

DomainStartEndE-ValueType
VWA 15 178 6.55e0 SMART
low complexity region 193 211 N/A INTRINSIC
Pfam:Med25_SD1 228 383 5.8e-55 PFAM
Pfam:Med25 396 546 3.9e-64 PFAM
low complexity region 577 592 N/A INTRINSIC
low complexity region 596 632 N/A INTRINSIC
Pfam:Med25_NR-box 657 745 5.3e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071207
SMART Domains Protein: ENSMUSP00000071194
Gene: ENSMUSG00000011658

DomainStartEndE-ValueType
low complexity region 234 259 N/A INTRINSIC
low complexity region 292 310 N/A INTRINSIC
low complexity region 382 391 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085399
SMART Domains Protein: ENSMUSP00000082519
Gene: ENSMUSG00000060279

DomainStartEndE-ValueType
Pfam:Adaptin_N 29 591 7.5e-150 PFAM
low complexity region 646 657 N/A INTRINSIC
low complexity region 665 675 N/A INTRINSIC
low complexity region 699 741 N/A INTRINSIC
Alpha_adaptinC2 745 858 4.49e-23 SMART
Pfam:Alpha_adaptin_C 864 972 9.4e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107857
SMART Domains Protein: ENSMUSP00000103489
Gene: ENSMUSG00000060279

DomainStartEndE-ValueType
Pfam:Adaptin_N 29 591 7e-150 PFAM
low complexity region 646 657 N/A INTRINSIC
low complexity region 665 675 N/A INTRINSIC
low complexity region 706 719 N/A INTRINSIC
Alpha_adaptinC2 723 836 4.49e-23 SMART
Pfam:Alpha_adaptin_C 842 950 9.1e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166972
SMART Domains Protein: ENSMUSP00000127842
Gene: ENSMUSG00000060279

DomainStartEndE-ValueType
Pfam:Adaptin_N 29 591 2e-149 PFAM
low complexity region 646 657 N/A INTRINSIC
low complexity region 665 675 N/A INTRINSIC
low complexity region 699 741 N/A INTRINSIC
Alpha_adaptinC2 745 858 4.49e-23 SMART
Pfam:Alpha_adaptin_C 864 972 5.4e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167930
SMART Domains Protein: ENSMUSP00000127497
Gene: ENSMUSG00000060279

DomainStartEndE-ValueType
Pfam:Adaptin_N 29 591 7e-150 PFAM
low complexity region 646 657 N/A INTRINSIC
low complexity region 665 675 N/A INTRINSIC
low complexity region 706 719 N/A INTRINSIC
Alpha_adaptinC2 723 836 4.49e-23 SMART
Pfam:Alpha_adaptin_C 842 950 9.1e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207069
Predicted Effect probably benign
Transcript: ENSMUST00000207154
Predicted Effect probably benign
Transcript: ENSMUST00000207278
Predicted Effect probably benign
Transcript: ENSMUST00000207485
Predicted Effect probably benign
Transcript: ENSMUST00000207654
Predicted Effect probably benign
Transcript: ENSMUST00000207788
Predicted Effect unknown
Transcript: ENSMUST00000209163
AA Change: V12A
Predicted Effect probably benign
Transcript: ENSMUST00000207939
Predicted Effect probably benign
Transcript: ENSMUST00000208179
Predicted Effect probably benign
Transcript: ENSMUST00000208253
Predicted Effect probably benign
Transcript: ENSMUST00000208472
Predicted Effect probably benign
Transcript: ENSMUST00000208551
Predicted Effect probably benign
Transcript: ENSMUST00000208556
Predicted Effect probably benign
Transcript: ENSMUST00000208600
Predicted Effect probably benign
Transcript: ENSMUST00000208908
Predicted Effect probably benign
Transcript: ENSMUST00000209039
Predicted Effect probably benign
Transcript: ENSMUST00000209132
Meta Mutation Damage Score 0.0647 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.0%
  • 20x: 95.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a planar cell polarity protein that is involved in ciliogenesis and directional cell movement. Knockout studies in mice exhibit neural tube defects and defective cilia, and mutations in this gene are associated with neural tube defects in humans. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit neural tube closure defects, abnormal craniofacial morphology, abnormal skeletal morphology, polydactyly, anopthalmia, pulmonary hopyplasia, and cardiac outflow tract defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,326,109 Y218N probably damaging Het
Abhd2 A G 7: 79,354,027 S285G probably benign Het
Afg1l T C 10: 42,478,374 T10A probably benign Het
Akap9 A G 5: 4,046,699 N2525D possibly damaging Het
B3gnt7 G A 1: 86,305,387 M1I probably null Het
Bdp1 T C 13: 100,037,761 E2089G probably null Het
Calcrl T G 2: 84,368,578 I156L probably benign Het
Cd69 T C 6: 129,269,580 S122G probably benign Het
Chek2 T C 5: 110,855,839 probably null Het
Ckap5 T A 2: 91,606,313 I1586K probably damaging Het
Cyp4f14 C T 17: 32,905,509 A523T probably benign Het
Dcaf1 T A 9: 106,846,772 C466* probably null Het
Dcdc2a A T 13: 25,120,389 probably benign Het
Eml5 T C 12: 98,876,180 I220V probably benign Het
Etv2 T C 7: 30,634,742 N189D probably benign Het
Fam19a2 A G 10: 123,704,373 T45A probably benign Het
Git1 T G 11: 77,499,521 V64G probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gpr162 C T 6: 124,861,309 R126H probably damaging Het
Grm5 T C 7: 87,602,923 V127A probably benign Het
Iqsec1 T C 6: 90,676,768 D665G probably damaging Het
Kcnh1 A G 1: 192,276,836 I233V probably damaging Het
Lmcd1 C T 6: 112,310,698 T115I probably damaging Het
Mybpc1 T C 10: 88,560,361 E208G possibly damaging Het
Nfic C A 10: 81,420,357 A158S probably benign Het
Nos3 A T 5: 24,380,243 I798L probably benign Het
Ntrk1 A T 3: 87,783,981 L292Q probably damaging Het
Olfr698 A G 7: 106,752,699 S230P possibly damaging Het
Orc4 T C 2: 48,927,184 Q164R probably benign Het
Pcdhb14 T A 18: 37,449,692 V617E probably damaging Het
Plscr3 G A 11: 69,847,958 E149K probably damaging Het
Pltp A G 2: 164,846,592 probably null Het
Pramef6 A G 4: 143,896,902 L234P probably damaging Het
Prg2 G A 2: 84,982,273 R109H probably benign Het
Ptprj G A 2: 90,580,403 S62F possibly damaging Het
Skint3 T A 4: 112,258,892 S240T probably damaging Het
Smarca5 A G 8: 80,704,751 Y946H probably damaging Het
Taf4b T C 18: 14,813,347 V409A possibly damaging Het
Trim29 T A 9: 43,327,112 N504K probably benign Het
Vmn2r77 T C 7: 86,802,994 Y461H probably damaging Het
Zeb2 T C 2: 44,997,318 K531E probably damaging Het
Zfp687 A G 3: 95,009,377 S813P possibly damaging Het
Other mutations in Fuz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01918:Fuz APN 7 44896959 missense probably damaging 1.00
R0211:Fuz UTSW 7 44899022 splice site probably null
R0586:Fuz UTSW 7 44898558 missense possibly damaging 0.59
R1028:Fuz UTSW 7 44896926 missense probably damaging 1.00
R1720:Fuz UTSW 7 44896991 missense probably damaging 1.00
R4969:Fuz UTSW 7 44900294 missense probably damaging 1.00
R5278:Fuz UTSW 7 44896277 missense probably benign 0.11
R5870:Fuz UTSW 7 44900318 missense probably damaging 1.00
R7440:Fuz UTSW 7 44896572 missense probably damaging 1.00
R8034:Fuz UTSW 7 44896260 start codon destroyed probably null
Predicted Primers PCR Primer
(F):5'- TTCATACACAGGGATCCAGACC -3'
(R):5'- AGTTCTGAGTTCCCCAGGAAG -3'

Sequencing Primer
(F):5'- AGACCTGGCCTTCCTCTCAAC -3'
(R):5'- TCGATGAGACAGTAGCTGGCC -3'
Posted On2018-11-28