Incidental Mutation 'R6972:Olfr698'
ID542303
Institutional Source Beutler Lab
Gene Symbol Olfr698
Ensembl Gene ENSMUSG00000059087
Gene Nameolfactory receptor 698
SynonymsMOR283-3, GA_x6K02T2PBJ9-9130754-9129519
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R6972 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location106749889-106755397 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106752699 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 230 (S230P)
Ref Sequence ENSEMBL: ENSMUSP00000149305 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074981] [ENSMUST00000214306] [ENSMUST00000216255]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074981
AA Change: S230P

PolyPhen 2 Score 0.599 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000074509
Gene: ENSMUSG00000059087
AA Change: S230P

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 9.4e-50 PFAM
Pfam:7TM_GPCR_Srsx 35 305 9.8e-8 PFAM
Pfam:7tm_1 41 290 4.1e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214306
AA Change: S230P

PolyPhen 2 Score 0.599 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216255
AA Change: S230P

PolyPhen 2 Score 0.599 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.0%
  • 20x: 95.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,326,109 Y218N probably damaging Het
Abhd2 A G 7: 79,354,027 S285G probably benign Het
Afg1l T C 10: 42,478,374 T10A probably benign Het
Akap9 A G 5: 4,046,699 N2525D possibly damaging Het
B3gnt7 G A 1: 86,305,387 M1I probably null Het
Bdp1 T C 13: 100,037,761 E2089G probably null Het
Calcrl T G 2: 84,368,578 I156L probably benign Het
Cd69 T C 6: 129,269,580 S122G probably benign Het
Chek2 T C 5: 110,855,839 probably null Het
Ckap5 T A 2: 91,606,313 I1586K probably damaging Het
Cyp4f14 C T 17: 32,905,509 A523T probably benign Het
Dcaf1 T A 9: 106,846,772 C466* probably null Het
Dcdc2a A T 13: 25,120,389 probably benign Het
Eml5 T C 12: 98,876,180 I220V probably benign Het
Etv2 T C 7: 30,634,742 N189D probably benign Het
Fam19a2 A G 10: 123,704,373 T45A probably benign Het
Fuz T C 7: 44,897,331 probably benign Het
Git1 T G 11: 77,499,521 V64G probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gpr162 C T 6: 124,861,309 R126H probably damaging Het
Grm5 T C 7: 87,602,923 V127A probably benign Het
Iqsec1 T C 6: 90,676,768 D665G probably damaging Het
Kcnh1 A G 1: 192,276,836 I233V probably damaging Het
Lmcd1 C T 6: 112,310,698 T115I probably damaging Het
Mybpc1 T C 10: 88,560,361 E208G possibly damaging Het
Nfic C A 10: 81,420,357 A158S probably benign Het
Nos3 A T 5: 24,380,243 I798L probably benign Het
Ntrk1 A T 3: 87,783,981 L292Q probably damaging Het
Orc4 T C 2: 48,927,184 Q164R probably benign Het
Pcdhb14 T A 18: 37,449,692 V617E probably damaging Het
Plscr3 G A 11: 69,847,958 E149K probably damaging Het
Pltp A G 2: 164,846,592 probably null Het
Pramef6 A G 4: 143,896,902 L234P probably damaging Het
Prg2 G A 2: 84,982,273 R109H probably benign Het
Ptprj G A 2: 90,580,403 S62F possibly damaging Het
Skint3 T A 4: 112,258,892 S240T probably damaging Het
Smarca5 A G 8: 80,704,751 Y946H probably damaging Het
Taf4b T C 18: 14,813,347 V409A possibly damaging Het
Trim29 T A 9: 43,327,112 N504K probably benign Het
Vmn2r77 T C 7: 86,802,994 Y461H probably damaging Het
Zeb2 T C 2: 44,997,318 K531E probably damaging Het
Zfp687 A G 3: 95,009,377 S813P possibly damaging Het
Other mutations in Olfr698
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01373:Olfr698 APN 7 106752446 utr 3 prime probably benign
IGL01901:Olfr698 APN 7 106752545 missense possibly damaging 0.52
IGL01912:Olfr698 APN 7 106752992 missense probably damaging 1.00
IGL01998:Olfr698 APN 7 106752551 missense possibly damaging 0.63
IGL02640:Olfr698 APN 7 106753352 missense probably damaging 1.00
IGL03195:Olfr698 APN 7 106752773 missense probably benign
R0255:Olfr698 UTSW 7 106752989 missense probably benign 0.19
R1104:Olfr698 UTSW 7 106752782 missense probably benign 0.37
R1796:Olfr698 UTSW 7 106752549 missense probably benign 0.02
R1909:Olfr698 UTSW 7 106752995 missense probably benign 0.21
R4133:Olfr698 UTSW 7 106753079 missense probably damaging 0.98
R5194:Olfr698 UTSW 7 106753219 missense probably benign 0.15
R5389:Olfr698 UTSW 7 106753083 missense probably damaging 0.99
R5426:Olfr698 UTSW 7 106752566 missense probably benign
R6162:Olfr698 UTSW 7 106753020 missense probably damaging 1.00
R6463:Olfr698 UTSW 7 106752801 missense probably benign 0.23
R6643:Olfr698 UTSW 7 106752569 missense probably benign 0.41
R6831:Olfr698 UTSW 7 106752571 missense probably damaging 0.99
R7392:Olfr698 UTSW 7 106753382 missense possibly damaging 0.69
R7717:Olfr698 UTSW 7 106752636 missense possibly damaging 0.58
R7852:Olfr698 UTSW 7 106752638 missense probably damaging 0.98
R8073:Olfr698 UTSW 7 106752801 nonsense probably null
R8245:Olfr698 UTSW 7 106753167 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TCAGAGCCGGAGTGACAATC -3'
(R):5'- ATCCCTCAGTGCTCTAGGATATAG -3'

Sequencing Primer
(F):5'- CCGGAGTGACAATCGTGTAG -3'
(R):5'- GTGCTCTAGGATATAGCATCTACACC -3'
Posted On2018-11-28