Mutagenetix > Incidental Mutation

Incidental Mutation 'R6972:Smarca5'

542304

Institutional Source

Beutler Lab

Gene Symbol

Smarca5

Ensembl Gene

ENSMUSG00000031715

Gene Name

SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5

Synonyms

D030040M08Rik, D330027N15Rik, 4933427E24Rik, MommeD4, Snf2h

MMRRC Submission

045082-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6972 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

80698507-80739497 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 80704751 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 946 (Y946H)

Ref Sequence

ENSEMBL: ENSMUSP00000044361 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043359]

AlphaFold

Q91ZW3

Predicted Effect

probably damaging
Transcript: ENSMUST00000043359
AA Change: Y946H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000044361
Gene: ENSMUSG00000031715
AA Change: Y946H

Domain	Start	End	E-Value	Type
low complexity region	2	53	N/A	INTRINSIC
Pfam:DBINO	65	112	1.1e-4	PFAM
low complexity region	145	156	N/A	INTRINSIC
DEXDc	175	367	3.9e-46	SMART
Blast:DEXDc	386	421	6e-11	BLAST
HELICc	512	596	6.2e-28	SMART
low complexity region	756	768	N/A	INTRINSIC
low complexity region	820	837	N/A	INTRINSIC
SANT	840	889	2.3e-7	SMART
SANT	942	1006	3e-7	SMART
low complexity region	1008	1024	N/A	INTRINSIC

Meta Mutation Damage Score

0.9218

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.0%
20x: 95.8%

Validation Efficiency

100% (41/41)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The protein encoded by this gene is a component of the chromatin remodeling and spacing factor RSF, a facilitator of the transcription of class II genes by RNA polymerase II. The encoded protein is similar in sequence to the Drosophila ISWI chromatin remodeling protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die during early embryonic development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810474O19Rik	T	A	6: 149,326,109	Y218N	probably damaging	Het
Abhd2	A	G	7: 79,354,027	S285G	probably benign	Het
Afg1l	T	C	10: 42,478,374	T10A	probably benign	Het
Akap9	A	G	5: 4,046,699	N2525D	possibly damaging	Het
B3gnt7	G	A	1: 86,305,387	M1I	probably null	Het
Bdp1	T	C	13: 100,037,761	E2089G	probably null	Het
Calcrl	T	G	2: 84,368,578	I156L	probably benign	Het
Cd69	T	C	6: 129,269,580	S122G	probably benign	Het
Chek2	T	C	5: 110,855,839		probably null	Het
Ckap5	T	A	2: 91,606,313	I1586K	probably damaging	Het
Cyp4f14	C	T	17: 32,905,509	A523T	probably benign	Het
Dcaf1	T	A	9: 106,846,772	C466*	probably null	Het
Dcdc2a	A	T	13: 25,120,389		probably benign	Het
Eml5	T	C	12: 98,876,180	I220V	probably benign	Het
Etv2	T	C	7: 30,634,742	N189D	probably benign	Het
Fam19a2	A	G	10: 123,704,373	T45A	probably benign	Het
Fuz	T	C	7: 44,897,331		probably benign	Het
Git1	T	G	11: 77,499,521	V64G	probably damaging	Het
Gm15922	C	G	7: 3,737,320	A301P	probably damaging	Het
Gpr162	C	T	6: 124,861,309	R126H	probably damaging	Het
Grm5	T	C	7: 87,602,923	V127A	probably benign	Het
Iqsec1	T	C	6: 90,676,768	D665G	probably damaging	Het
Kcnh1	A	G	1: 192,276,836	I233V	probably damaging	Het
Lmcd1	C	T	6: 112,310,698	T115I	probably damaging	Het
Mybpc1	T	C	10: 88,560,361	E208G	possibly damaging	Het
Nfic	C	A	10: 81,420,357	A158S	probably benign	Het
Nos3	A	T	5: 24,380,243	I798L	probably benign	Het
Ntrk1	A	T	3: 87,783,981	L292Q	probably damaging	Het
Olfr698	A	G	7: 106,752,699	S230P	possibly damaging	Het
Orc4	T	C	2: 48,927,184	Q164R	probably benign	Het
Pcdhb14	T	A	18: 37,449,692	V617E	probably damaging	Het
Plscr3	G	A	11: 69,847,958	E149K	probably damaging	Het
Pltp	A	G	2: 164,846,592		probably null	Het
Pramef6	A	G	4: 143,896,902	L234P	probably damaging	Het
Prg2	G	A	2: 84,982,273	R109H	probably benign	Het
Ptprj	G	A	2: 90,580,403	S62F	possibly damaging	Het
Skint3	T	A	4: 112,258,892	S240T	probably damaging	Het
Taf4b	T	C	18: 14,813,347	V409A	possibly damaging	Het
Trim29	T	A	9: 43,327,112	N504K	probably benign	Het
Vmn2r77	T	C	7: 86,802,994	Y461H	probably damaging	Het
Zeb2	T	C	2: 44,997,318	K531E	probably damaging	Het
Zfp687	A	G	3: 95,009,377	S813P	possibly damaging	Het

Other mutations in Smarca5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00323:Smarca5	APN	8	80714041	missense	probably benign	0.10
IGL01138:Smarca5	APN	8	80701076	missense	possibly damaging	0.87
IGL01290:Smarca5	APN	8	80727648	missense	probably benign
IGL02338:Smarca5	APN	8	80719570	splice site	probably benign
IGL03212:Smarca5	APN	8	80711781	missense	possibly damaging	0.47
IGL03216:Smarca5	APN	8	80719658	missense	probably damaging	1.00
Cipher	UTSW	8	80719652	missense	probably damaging	1.00
Codebook	UTSW	8	80733707	missense	probably benign
Codex	UTSW	8	80710563	missense	probably damaging	0.99
Encryption	UTSW	8	80704726	missense	probably damaging	1.00
Enigma	UTSW	8	80705332	missense	probably benign	0.35
Key	UTSW	8	80726051	missense	probably damaging	1.00
Sailor	UTSW	8	80736726	missense	probably benign	0.07
Soldier	UTSW	8	80719715	missense	probably damaging	1.00
tinker	UTSW	8	80733750	missense	probably benign
R0254:Smarca5	UTSW	8	80704700	missense	probably benign	0.05
R0374:Smarca5	UTSW	8	80736731	missense	probably benign	0.30
R0625:Smarca5	UTSW	8	80720686	critical splice donor site	probably null
R1065:Smarca5	UTSW	8	80704714	missense	probably damaging	1.00
R1164:Smarca5	UTSW	8	80710631	missense	probably damaging	1.00
R1709:Smarca5	UTSW	8	80709220	nonsense	probably null
R2102:Smarca5	UTSW	8	80704675	missense	probably damaging	1.00
R3831:Smarca5	UTSW	8	80728494	missense	probably damaging	0.99
R4625:Smarca5	UTSW	8	80710563	missense	probably damaging	0.99
R4750:Smarca5	UTSW	8	80733707	missense	probably benign
R4822:Smarca5	UTSW	8	80708680	splice site	probably null
R4889:Smarca5	UTSW	8	80704697	missense	possibly damaging	0.95
R5756:Smarca5	UTSW	8	80710604	missense	probably benign
R6120:Smarca5	UTSW	8	80711743	missense	probably damaging	0.98
R6582:Smarca5	UTSW	8	80719652	missense	probably damaging	1.00
R6939:Smarca5	UTSW	8	80705320	missense	possibly damaging	0.63
R6973:Smarca5	UTSW	8	80704751	missense	probably damaging	1.00
R7027:Smarca5	UTSW	8	80736726	missense	probably benign	0.07
R7376:Smarca5	UTSW	8	80726051	missense	probably damaging	1.00
R7514:Smarca5	UTSW	8	80717534	missense	probably damaging	1.00
R7962:Smarca5	UTSW	8	80736759	missense	probably benign
R8031:Smarca5	UTSW	8	80704682	missense	probably damaging	1.00
R8400:Smarca5	UTSW	8	80709127	missense	probably benign	0.02
R8798:Smarca5	UTSW	8	80716508	missense	probably damaging	1.00
R8817:Smarca5	UTSW	8	80733750	missense	probably benign
R8824:Smarca5	UTSW	8	80705332	missense	probably benign	0.35
R8905:Smarca5	UTSW	8	80713948	missense	probably benign	0.14
R9018:Smarca5	UTSW	8	80704726	missense	probably damaging	1.00
R9028:Smarca5	UTSW	8	80714013	missense	probably damaging	1.00
R9203:Smarca5	UTSW	8	80704629	nonsense	probably null
R9253:Smarca5	UTSW	8	80719715	missense	probably damaging	1.00
R9294:Smarca5	UTSW	8	80719803	missense	probably damaging	1.00
R9328:Smarca5	UTSW	8	80720749	missense	probably benign	0.00
R9396:Smarca5	UTSW	8	80736729	missense	probably benign	0.00
R9514:Smarca5	UTSW	8	80702211	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCTGCATTACACAAACCTTG -3'
(R):5'- GACCCCATTTCTTGTAGTCACAAC -3'

Sequencing Primer
(F):5'- TTGTACACTCACCATCGCAG -3'
(R):5'- CCCATTTCTTGTAGTCACAACAATAG -3'

Posted On

2018-11-28