Incidental Mutation 'R6972:Trim29'
ID542305
Institutional Source Beutler Lab
Gene Symbol Trim29
Ensembl Gene ENSMUSG00000032013
Gene Nametripartite motif-containing 29
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6972 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location43310848-43336115 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 43327112 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 504 (N504K)
Ref Sequence ENSEMBL: ENSMUSP00000034511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034511]
Predicted Effect probably benign
Transcript: ENSMUST00000034511
AA Change: N504K

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000034511
Gene: ENSMUSG00000032013
AA Change: N504K

DomainStartEndE-ValueType
Blast:BBOX 168 216 3e-25 BLAST
BBOX 220 260 1.93e-11 SMART
low complexity region 399 410 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.0%
  • 20x: 95.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the TRIM protein family. It has multiple zinc finger motifs and a leucine zipper motif. It has been proposed to form homo- or heterodimers which are involved in nucleic acid binding. Thus, it may act as a transcriptional regulatory factor involved in carcinogenesis and/or differentiation. It may also function in the suppression of radiosensitivity since it is associated with ataxia telangiectasia phenotype. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,326,109 Y218N probably damaging Het
Abhd2 A G 7: 79,354,027 S285G probably benign Het
Afg1l T C 10: 42,478,374 T10A probably benign Het
Akap9 A G 5: 4,046,699 N2525D possibly damaging Het
B3gnt7 G A 1: 86,305,387 M1I probably null Het
Bdp1 T C 13: 100,037,761 E2089G probably null Het
Calcrl T G 2: 84,368,578 I156L probably benign Het
Cd69 T C 6: 129,269,580 S122G probably benign Het
Chek2 T C 5: 110,855,839 probably null Het
Ckap5 T A 2: 91,606,313 I1586K probably damaging Het
Cyp4f14 C T 17: 32,905,509 A523T probably benign Het
Dcaf1 T A 9: 106,846,772 C466* probably null Het
Dcdc2a A T 13: 25,120,389 probably benign Het
Eml5 T C 12: 98,876,180 I220V probably benign Het
Etv2 T C 7: 30,634,742 N189D probably benign Het
Fam19a2 A G 10: 123,704,373 T45A probably benign Het
Fuz T C 7: 44,897,331 probably benign Het
Git1 T G 11: 77,499,521 V64G probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gpr162 C T 6: 124,861,309 R126H probably damaging Het
Grm5 T C 7: 87,602,923 V127A probably benign Het
Iqsec1 T C 6: 90,676,768 D665G probably damaging Het
Kcnh1 A G 1: 192,276,836 I233V probably damaging Het
Lmcd1 C T 6: 112,310,698 T115I probably damaging Het
Mybpc1 T C 10: 88,560,361 E208G possibly damaging Het
Nfic C A 10: 81,420,357 A158S probably benign Het
Nos3 A T 5: 24,380,243 I798L probably benign Het
Ntrk1 A T 3: 87,783,981 L292Q probably damaging Het
Olfr698 A G 7: 106,752,699 S230P possibly damaging Het
Orc4 T C 2: 48,927,184 Q164R probably benign Het
Pcdhb14 T A 18: 37,449,692 V617E probably damaging Het
Plscr3 G A 11: 69,847,958 E149K probably damaging Het
Pltp A G 2: 164,846,592 probably null Het
Pramef6 A G 4: 143,896,902 L234P probably damaging Het
Prg2 G A 2: 84,982,273 R109H probably benign Het
Ptprj G A 2: 90,580,403 S62F possibly damaging Het
Skint3 T A 4: 112,258,892 S240T probably damaging Het
Smarca5 A G 8: 80,704,751 Y946H probably damaging Het
Taf4b T C 18: 14,813,347 V409A possibly damaging Het
Vmn2r77 T C 7: 86,802,994 Y461H probably damaging Het
Zeb2 T C 2: 44,997,318 K531E probably damaging Het
Zfp687 A G 3: 95,009,377 S813P possibly damaging Het
Other mutations in Trim29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02364:Trim29 APN 9 43311302 missense probably benign 0.05
IGL02387:Trim29 APN 9 43324852 missense probably benign 0.02
R1770:Trim29 UTSW 9 43332376 missense probably damaging 1.00
R1883:Trim29 UTSW 9 43311405 missense probably damaging 1.00
R1962:Trim29 UTSW 9 43311318 missense probably benign
R4198:Trim29 UTSW 9 43311380 nonsense probably null
R4200:Trim29 UTSW 9 43311380 nonsense probably null
R4303:Trim29 UTSW 9 43311122 missense probably damaging 1.00
R4863:Trim29 UTSW 9 43329575 missense possibly damaging 0.89
R4934:Trim29 UTSW 9 43310968 missense probably benign 0.36
R6171:Trim29 UTSW 9 43319377 missense probably damaging 1.00
R6737:Trim29 UTSW 9 43319384 missense probably benign 0.01
R7191:Trim29 UTSW 9 43311609 missense probably damaging 1.00
R7434:Trim29 UTSW 9 43335131 missense probably damaging 1.00
R7588:Trim29 UTSW 9 43335128 missense probably damaging 1.00
R7590:Trim29 UTSW 9 43311491 missense probably damaging 1.00
X0065:Trim29 UTSW 9 43322324 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TGGAAGAGTTCAAAGGGCTC -3'
(R):5'- AGTTCTGCATAAGCCAGTGC -3'

Sequencing Primer
(F):5'- AGTTCAAAGGGCTCTGGGG -3'
(R):5'- TGCATAAGCCAGTGCAGTTC -3'
Posted On2018-11-28