Incidental Mutation 'R6972:Afg1l'
ID542307
Institutional Source Beutler Lab
Gene Symbol Afg1l
Ensembl Gene ENSMUSG00000038302
Gene NameAFG1 like ATPase
SynonymsLace1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R6972 (G1)
Quality Score160.009
Status Validated
Chromosome10
Chromosomal Location42312585-42478565 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 42478374 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 10 (T10A)
Ref Sequence ENSEMBL: ENSMUSP00000123510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041024] [ENSMUST00000133326]
Predicted Effect probably benign
Transcript: ENSMUST00000041024
AA Change: T10A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000036149
Gene: ENSMUSG00000038302
AA Change: T10A

DomainStartEndE-ValueType
low complexity region 21 32 N/A INTRINSIC
low complexity region 34 43 N/A INTRINSIC
Pfam:AFG1_ATPase 74 432 4.4e-110 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133326
AA Change: T10A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000123510
Gene: ENSMUSG00000038302
AA Change: T10A

DomainStartEndE-ValueType
low complexity region 21 32 N/A INTRINSIC
low complexity region 34 43 N/A INTRINSIC
Pfam:AFG1_ATPase 73 272 2e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151747
SMART Domains Protein: ENSMUSP00000120389
Gene: ENSMUSG00000038302

DomainStartEndE-ValueType
Pfam:AFG1_ATPase 5 300 2e-97 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.0%
  • 20x: 95.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial integral membrane protein that plays a role in mitochondrial protein homeostasis. The protein contains a P-loop motif and a five-domain structure that is conserved in fly, yeast, and bacteria. It functions to mediate the degradation of nuclear-encoded complex IV subunits. Two conserved estrogen receptor binding sites are located within 2.5 kb of this gene. Polymorphisms in this gene have been associated with bipolar disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2016]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,326,109 Y218N probably damaging Het
Abhd2 A G 7: 79,354,027 S285G probably benign Het
Akap9 A G 5: 4,046,699 N2525D possibly damaging Het
B3gnt7 G A 1: 86,305,387 M1I probably null Het
Bdp1 T C 13: 100,037,761 E2089G probably null Het
Calcrl T G 2: 84,368,578 I156L probably benign Het
Cd69 T C 6: 129,269,580 S122G probably benign Het
Chek2 T C 5: 110,855,839 probably null Het
Ckap5 T A 2: 91,606,313 I1586K probably damaging Het
Cyp4f14 C T 17: 32,905,509 A523T probably benign Het
Dcaf1 T A 9: 106,846,772 C466* probably null Het
Dcdc2a A T 13: 25,120,389 probably benign Het
Eml5 T C 12: 98,876,180 I220V probably benign Het
Etv2 T C 7: 30,634,742 N189D probably benign Het
Fam19a2 A G 10: 123,704,373 T45A probably benign Het
Fuz T C 7: 44,897,331 probably benign Het
Git1 T G 11: 77,499,521 V64G probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gpr162 C T 6: 124,861,309 R126H probably damaging Het
Grm5 T C 7: 87,602,923 V127A probably benign Het
Iqsec1 T C 6: 90,676,768 D665G probably damaging Het
Kcnh1 A G 1: 192,276,836 I233V probably damaging Het
Lmcd1 C T 6: 112,310,698 T115I probably damaging Het
Mybpc1 T C 10: 88,560,361 E208G possibly damaging Het
Nfic C A 10: 81,420,357 A158S probably benign Het
Nos3 A T 5: 24,380,243 I798L probably benign Het
Ntrk1 A T 3: 87,783,981 L292Q probably damaging Het
Olfr698 A G 7: 106,752,699 S230P possibly damaging Het
Orc4 T C 2: 48,927,184 Q164R probably benign Het
Pcdhb14 T A 18: 37,449,692 V617E probably damaging Het
Plscr3 G A 11: 69,847,958 E149K probably damaging Het
Pltp A G 2: 164,846,592 probably null Het
Pramef6 A G 4: 143,896,902 L234P probably damaging Het
Prg2 G A 2: 84,982,273 R109H probably benign Het
Ptprj G A 2: 90,580,403 S62F possibly damaging Het
Skint3 T A 4: 112,258,892 S240T probably damaging Het
Smarca5 A G 8: 80,704,751 Y946H probably damaging Het
Taf4b T C 18: 14,813,347 V409A possibly damaging Het
Trim29 T A 9: 43,327,112 N504K probably benign Het
Vmn2r77 T C 7: 86,802,994 Y461H probably damaging Het
Zeb2 T C 2: 44,997,318 K531E probably damaging Het
Zfp687 A G 3: 95,009,377 S813P possibly damaging Het
Other mutations in Afg1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01863:Afg1l APN 10 42339911 missense possibly damaging 0.86
IGL02041:Afg1l APN 10 42454380 missense probably damaging 0.98
IGL02309:Afg1l APN 10 42454378 missense possibly damaging 0.90
IGL02323:Afg1l APN 10 42454510 nonsense probably null
IGL03088:Afg1l APN 10 42426497 missense probably damaging 1.00
PIT4458001:Afg1l UTSW 10 42454370 nonsense probably null
R0969:Afg1l UTSW 10 42318621 missense probably damaging 1.00
R1665:Afg1l UTSW 10 42426577 missense probably damaging 1.00
R1703:Afg1l UTSW 10 42400399 missense probably damaging 1.00
R1766:Afg1l UTSW 10 42454495 missense probably benign 0.00
R2941:Afg1l UTSW 10 42478295 splice site probably null
R4846:Afg1l UTSW 10 42454494 missense probably benign 0.02
R4887:Afg1l UTSW 10 42454378 missense probably benign 0.00
R5668:Afg1l UTSW 10 42360240 missense probably damaging 1.00
R5934:Afg1l UTSW 10 42318686 missense probably damaging 1.00
R6575:Afg1l UTSW 10 42318716 missense probably damaging 1.00
R7270:Afg1l UTSW 10 42425249 missense probably damaging 1.00
R7271:Afg1l UTSW 10 42415548 critical splice donor site probably null
R7577:Afg1l UTSW 10 42318611 missense probably damaging 1.00
R8458:Afg1l UTSW 10 42426521 missense probably damaging 0.98
Z1176:Afg1l UTSW 10 42478353 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGGTCAATAGACACGAACTCG -3'
(R):5'- TTGCAGCCTTTCTAAGCTTGAGG -3'

Sequencing Primer
(F):5'- GGATCCTTACAACTTGTGAAGCC -3'
(R):5'- AAGCTTGAGGTCATCTCTCTTTAACG -3'
Posted On2018-11-28