Incidental Mutation 'R6972:Nfic'
ID542308
Institutional Source Beutler Lab
Gene Symbol Nfic
Ensembl Gene ENSMUSG00000055053
Gene Namenuclear factor I/C
Synonymsnuclear factor 1-C2, 1110019L22Rik, NF1-C, 1500041O16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.368) question?
Stock #R6972 (G1)
Quality Score197.009
Status Validated
Chromosome10
Chromosomal Location81396186-81455635 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 81420357 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 158 (A158S)
Ref Sequence ENSEMBL: ENSMUSP00000020461 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020461] [ENSMUST00000078185] [ENSMUST00000105321] [ENSMUST00000117966] [ENSMUST00000221817]
Predicted Effect probably benign
Transcript: ENSMUST00000020461
AA Change: A158S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000020461
Gene: ENSMUSG00000055053
AA Change: A158S

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 7 47 4.6e-30 PFAM
DWA 68 176 5.77e-24 SMART
Pfam:CTF_NFI 217 428 2e-107 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000078185
AA Change: A158S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000077317
Gene: ENSMUSG00000055053
AA Change: A158S

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 4 47 9.5e-31 PFAM
DWA 68 176 5.77e-24 SMART
Pfam:CTF_NFI 217 323 1.4e-52 PFAM
Pfam:CTF_NFI 316 387 1.7e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105321
AA Change: A158S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000100958
Gene: ENSMUSG00000055053
AA Change: A158S

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 4 47 8e-31 PFAM
DWA 68 176 5.77e-24 SMART
Pfam:CTF_NFI 217 426 5.2e-106 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117966
AA Change: A149S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113046
Gene: ENSMUSG00000055053
AA Change: A149S

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 1 38 1.3e-27 PFAM
DWA 59 167 5.77e-24 SMART
Pfam:CTF_NFI 208 421 1.9e-106 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221817
AA Change: A180S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.0%
  • 20x: 95.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the CTF/NF-I family. These are dimeric DNA-binding proteins, and function as cellular transcription factors and as replication factors for adenovirus DNA replication. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a targeted null allele have abnormal incisor and molar root development, show reduced alveolar bone formation, and exhibit impaired feeding leading to severe runting and premature death when reared on standard laboratory chow. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,326,109 Y218N probably damaging Het
Abhd2 A G 7: 79,354,027 S285G probably benign Het
Afg1l T C 10: 42,478,374 T10A probably benign Het
Akap9 A G 5: 4,046,699 N2525D possibly damaging Het
B3gnt7 G A 1: 86,305,387 M1I probably null Het
Bdp1 T C 13: 100,037,761 E2089G probably null Het
Calcrl T G 2: 84,368,578 I156L probably benign Het
Cd69 T C 6: 129,269,580 S122G probably benign Het
Chek2 T C 5: 110,855,839 probably null Het
Ckap5 T A 2: 91,606,313 I1586K probably damaging Het
Cyp4f14 C T 17: 32,905,509 A523T probably benign Het
Dcaf1 T A 9: 106,846,772 C466* probably null Het
Dcdc2a A T 13: 25,120,389 probably benign Het
Eml5 T C 12: 98,876,180 I220V probably benign Het
Etv2 T C 7: 30,634,742 N189D probably benign Het
Fam19a2 A G 10: 123,704,373 T45A probably benign Het
Fuz T C 7: 44,897,331 probably benign Het
Git1 T G 11: 77,499,521 V64G probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gpr162 C T 6: 124,861,309 R126H probably damaging Het
Grm5 T C 7: 87,602,923 V127A probably benign Het
Iqsec1 T C 6: 90,676,768 D665G probably damaging Het
Kcnh1 A G 1: 192,276,836 I233V probably damaging Het
Lmcd1 C T 6: 112,310,698 T115I probably damaging Het
Mybpc1 T C 10: 88,560,361 E208G possibly damaging Het
Nos3 A T 5: 24,380,243 I798L probably benign Het
Ntrk1 A T 3: 87,783,981 L292Q probably damaging Het
Olfr698 A G 7: 106,752,699 S230P possibly damaging Het
Orc4 T C 2: 48,927,184 Q164R probably benign Het
Pcdhb14 T A 18: 37,449,692 V617E probably damaging Het
Plscr3 G A 11: 69,847,958 E149K probably damaging Het
Pltp A G 2: 164,846,592 probably null Het
Pramef6 A G 4: 143,896,902 L234P probably damaging Het
Prg2 G A 2: 84,982,273 R109H probably benign Het
Ptprj G A 2: 90,580,403 S62F possibly damaging Het
Skint3 T A 4: 112,258,892 S240T probably damaging Het
Smarca5 A G 8: 80,704,751 Y946H probably damaging Het
Taf4b T C 18: 14,813,347 V409A possibly damaging Het
Trim29 T A 9: 43,327,112 N504K probably benign Het
Vmn2r77 T C 7: 86,802,994 Y461H probably damaging Het
Zeb2 T C 2: 44,997,318 K531E probably damaging Het
Zfp687 A G 3: 95,009,377 S813P possibly damaging Het
Other mutations in Nfic
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Nfic APN 10 81408220 missense possibly damaging 0.94
IGL01486:Nfic APN 10 81407644 splice site probably null
IGL01784:Nfic APN 10 81406148 missense possibly damaging 0.70
IGL02053:Nfic APN 10 81420551 missense probably damaging 1.00
IGL03128:Nfic APN 10 81406191 missense probably benign 0.21
sterb UTSW 10 81420800 critical splice acceptor site probably null
Stronger UTSW 10 81420500 missense probably damaging 1.00
Taller UTSW 10 81406087 critical splice donor site probably null
R0113:Nfic UTSW 10 81420585 missense probably damaging 1.00
R1468:Nfic UTSW 10 81420580 missense probably damaging 1.00
R1468:Nfic UTSW 10 81420580 missense probably damaging 1.00
R1807:Nfic UTSW 10 81404985 missense probably benign 0.21
R1872:Nfic UTSW 10 81420684 missense possibly damaging 0.89
R2295:Nfic UTSW 10 81420531 missense probably damaging 1.00
R2324:Nfic UTSW 10 81406087 critical splice donor site probably null
R5992:Nfic UTSW 10 81420747 missense probably damaging 1.00
R6260:Nfic UTSW 10 81420517 nonsense probably null
R6973:Nfic UTSW 10 81420357 missense probably benign 0.00
R6982:Nfic UTSW 10 81420800 critical splice acceptor site probably null
R7158:Nfic UTSW 10 81420605 missense probably damaging 1.00
R7682:Nfic UTSW 10 81420500 missense probably damaging 1.00
X0065:Nfic UTSW 10 81427098 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ATGACCCTATCCAGGCTCCTAC -3'
(R):5'- TACTGGCTGTGACTGGCAAG -3'

Sequencing Primer
(F):5'- ATCCAGGCTCCTACCCCTG -3'
(R):5'- CTGTGACTGGCAAGAAGGC -3'
Posted On2018-11-28