Incidental Mutation 'R6972:Fam19a2'
ID542310
Institutional Source Beutler Lab
Gene Symbol Fam19a2
Ensembl Gene ENSMUSG00000044071
Gene Namefamily with sequence similarity 19, member A2
SynonymsTafa-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R6972 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location123263996-123741204 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123704373 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 45 (T45A)
Ref Sequence ENSEMBL: ENSMUSP00000050199 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050756]
Predicted Effect probably benign
Transcript: ENSMUST00000050756
AA Change: T45A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000050199
Gene: ENSMUSG00000044071
AA Change: T45A

DomainStartEndE-ValueType
Pfam:TAFA 45 133 6.8e-51 PFAM
Meta Mutation Damage Score 0.0803 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.0%
  • 20x: 95.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: This gene is a member of the TAFA family which is composed of five highly homologous genes that encode small secreted proteins. These proteins contain conserved cysteine residues at fixed positions, and are distantly related to MIP-1alpha, a member of the CC-chemokine family. The TAFA proteins are predominantly expressed in specific regions of the brain, and are postulated to function as brain-specific chemokines or neurokines that act as regulators of immune and nervous cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased anxiety-like and fear-related behaviors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,326,109 Y218N probably damaging Het
Abhd2 A G 7: 79,354,027 S285G probably benign Het
Afg1l T C 10: 42,478,374 T10A probably benign Het
Akap9 A G 5: 4,046,699 N2525D possibly damaging Het
B3gnt7 G A 1: 86,305,387 M1I probably null Het
Bdp1 T C 13: 100,037,761 E2089G probably null Het
Calcrl T G 2: 84,368,578 I156L probably benign Het
Cd69 T C 6: 129,269,580 S122G probably benign Het
Chek2 T C 5: 110,855,839 probably null Het
Ckap5 T A 2: 91,606,313 I1586K probably damaging Het
Cyp4f14 C T 17: 32,905,509 A523T probably benign Het
Dcaf1 T A 9: 106,846,772 C466* probably null Het
Dcdc2a A T 13: 25,120,389 probably benign Het
Eml5 T C 12: 98,876,180 I220V probably benign Het
Etv2 T C 7: 30,634,742 N189D probably benign Het
Fuz T C 7: 44,897,331 probably benign Het
Git1 T G 11: 77,499,521 V64G probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gpr162 C T 6: 124,861,309 R126H probably damaging Het
Grm5 T C 7: 87,602,923 V127A probably benign Het
Iqsec1 T C 6: 90,676,768 D665G probably damaging Het
Kcnh1 A G 1: 192,276,836 I233V probably damaging Het
Lmcd1 C T 6: 112,310,698 T115I probably damaging Het
Mybpc1 T C 10: 88,560,361 E208G possibly damaging Het
Nfic C A 10: 81,420,357 A158S probably benign Het
Nos3 A T 5: 24,380,243 I798L probably benign Het
Ntrk1 A T 3: 87,783,981 L292Q probably damaging Het
Olfr698 A G 7: 106,752,699 S230P possibly damaging Het
Orc4 T C 2: 48,927,184 Q164R probably benign Het
Pcdhb14 T A 18: 37,449,692 V617E probably damaging Het
Plscr3 G A 11: 69,847,958 E149K probably damaging Het
Pltp A G 2: 164,846,592 probably null Het
Pramef6 A G 4: 143,896,902 L234P probably damaging Het
Prg2 G A 2: 84,982,273 R109H probably benign Het
Ptprj G A 2: 90,580,403 S62F possibly damaging Het
Skint3 T A 4: 112,258,892 S240T probably damaging Het
Smarca5 A G 8: 80,704,751 Y946H probably damaging Het
Taf4b T C 18: 14,813,347 V409A possibly damaging Het
Trim29 T A 9: 43,327,112 N504K probably benign Het
Vmn2r77 T C 7: 86,802,994 Y461H probably damaging Het
Zeb2 T C 2: 44,997,318 K531E probably damaging Het
Zfp687 A G 3: 95,009,377 S813P possibly damaging Het
Other mutations in Fam19a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
dolorous UTSW 10 123704392 missense probably damaging 1.00
Lugubrious UTSW 10 123593496 missense possibly damaging 0.86
R0395:Fam19a2 UTSW 10 123593592 missense probably benign 0.05
R1478:Fam19a2 UTSW 10 123593496 missense possibly damaging 0.86
R2869:Fam19a2 UTSW 10 123704365 missense possibly damaging 0.63
R2869:Fam19a2 UTSW 10 123704365 missense possibly damaging 0.63
R2870:Fam19a2 UTSW 10 123704365 missense possibly damaging 0.63
R2870:Fam19a2 UTSW 10 123704365 missense possibly damaging 0.63
R2873:Fam19a2 UTSW 10 123704365 missense possibly damaging 0.63
R6537:Fam19a2 UTSW 10 123593496 missense possibly damaging 0.86
R6589:Fam19a2 UTSW 10 123704392 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCCAAGCATTTACCGATGG -3'
(R):5'- CCGATTCCAACCATGCTATTAC -3'

Sequencing Primer
(F):5'- TACCGATGGAAATGGTCTCTGCAC -3'
(R):5'- CCATGCTATTACAAAGAGCAATGG -3'
Posted On2018-11-28