Incidental Mutation 'R6972:Plscr3'
ID542311
Institutional Source Beutler Lab
Gene Symbol Plscr3
Ensembl Gene ENSMUSG00000019461
Gene Namephospholipid scramblase 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6972 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location69846376-69852058 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 69847958 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 149 (E149K)
Ref Sequence ENSEMBL: ENSMUSP00000123549 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001626] [ENSMUST00000019605] [ENSMUST00000108628] [ENSMUST00000108632] [ENSMUST00000108633] [ENSMUST00000152566] [ENSMUST00000156507]
Predicted Effect probably benign
Transcript: ENSMUST00000001626
SMART Domains Protein: ENSMUSP00000001626
Gene: ENSMUSG00000001583

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
Blast:TyrKc 43 80 1e-5 BLAST
TyrKc 116 378 1.2e-108 SMART
SH3 384 440 4.11e-1 SMART
low complexity region 504 517 N/A INTRINSIC
low complexity region 528 544 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000019605
AA Change: E149K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000019605
Gene: ENSMUSG00000019461
AA Change: E149K

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
low complexity region 32 49 N/A INTRINSIC
Pfam:Scramblase 63 285 1.7e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108628
SMART Domains Protein: ENSMUSP00000104268
Gene: ENSMUSG00000001583

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
Blast:TyrKc 43 80 1e-5 BLAST
TyrKc 116 378 1.2e-108 SMART
SH3 384 445 6.1e-1 SMART
low complexity region 509 522 N/A INTRINSIC
low complexity region 533 549 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108632
AA Change: E149K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104272
Gene: ENSMUSG00000019461
AA Change: E149K

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
low complexity region 32 49 N/A INTRINSIC
Pfam:Scramblase 63 285 1.7e-88 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108633
AA Change: E149K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104273
Gene: ENSMUSG00000019461
AA Change: E149K

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
low complexity region 32 49 N/A INTRINSIC
Pfam:Scramblase 63 285 1.7e-88 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000152566
AA Change: E149K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123549
Gene: ENSMUSG00000019461
AA Change: E149K

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
low complexity region 32 49 N/A INTRINSIC
Pfam:Scramblase 63 224 2.1e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156507
SMART Domains Protein: ENSMUSP00000120585
Gene: ENSMUSG00000001583

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 76 8.4e-17 PFAM
Pfam:Pkinase 1 97 1.2e-6 PFAM
low complexity region 127 140 N/A INTRINSIC
low complexity region 151 167 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.0%
  • 20x: 95.8%
Validation Efficiency 100% (41/41)
MGI Phenotype PHENOTYPE: Homozygous null mice display lipid-engorged adipocytes, increased abdominal fat stores, mild hyperglycemia, dyslipidemia, impaired glucose tolerance, insulin resistance, altered plasma adiponectin and leptin levels, and impaired insulin-stimulated glucose uptake by adipocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,326,109 Y218N probably damaging Het
Abhd2 A G 7: 79,354,027 S285G probably benign Het
Afg1l T C 10: 42,478,374 T10A probably benign Het
Akap9 A G 5: 4,046,699 N2525D possibly damaging Het
B3gnt7 G A 1: 86,305,387 M1I probably null Het
Bdp1 T C 13: 100,037,761 E2089G probably null Het
Calcrl T G 2: 84,368,578 I156L probably benign Het
Cd69 T C 6: 129,269,580 S122G probably benign Het
Chek2 T C 5: 110,855,839 probably null Het
Ckap5 T A 2: 91,606,313 I1586K probably damaging Het
Cyp4f14 C T 17: 32,905,509 A523T probably benign Het
Dcaf1 T A 9: 106,846,772 C466* probably null Het
Dcdc2a A T 13: 25,120,389 probably benign Het
Eml5 T C 12: 98,876,180 I220V probably benign Het
Etv2 T C 7: 30,634,742 N189D probably benign Het
Fam19a2 A G 10: 123,704,373 T45A probably benign Het
Fuz T C 7: 44,897,331 probably benign Het
Git1 T G 11: 77,499,521 V64G probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gpr162 C T 6: 124,861,309 R126H probably damaging Het
Grm5 T C 7: 87,602,923 V127A probably benign Het
Iqsec1 T C 6: 90,676,768 D665G probably damaging Het
Kcnh1 A G 1: 192,276,836 I233V probably damaging Het
Lmcd1 C T 6: 112,310,698 T115I probably damaging Het
Mybpc1 T C 10: 88,560,361 E208G possibly damaging Het
Nfic C A 10: 81,420,357 A158S probably benign Het
Nos3 A T 5: 24,380,243 I798L probably benign Het
Ntrk1 A T 3: 87,783,981 L292Q probably damaging Het
Olfr698 A G 7: 106,752,699 S230P possibly damaging Het
Orc4 T C 2: 48,927,184 Q164R probably benign Het
Pcdhb14 T A 18: 37,449,692 V617E probably damaging Het
Pltp A G 2: 164,846,592 probably null Het
Pramef6 A G 4: 143,896,902 L234P probably damaging Het
Prg2 G A 2: 84,982,273 R109H probably benign Het
Ptprj G A 2: 90,580,403 S62F possibly damaging Het
Skint3 T A 4: 112,258,892 S240T probably damaging Het
Smarca5 A G 8: 80,704,751 Y946H probably damaging Het
Taf4b T C 18: 14,813,347 V409A possibly damaging Het
Trim29 T A 9: 43,327,112 N504K probably benign Het
Vmn2r77 T C 7: 86,802,994 Y461H probably damaging Het
Zeb2 T C 2: 44,997,318 K531E probably damaging Het
Zfp687 A G 3: 95,009,377 S813P possibly damaging Het
Other mutations in Plscr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01672:Plscr3 APN 11 69847682 missense possibly damaging 0.54
IGL02496:Plscr3 APN 11 69847383 unclassified probably benign
R0256:Plscr3 UTSW 11 69850054 missense probably damaging 1.00
R0639:Plscr3 UTSW 11 69847994 missense probably benign 0.06
R3824:Plscr3 UTSW 11 69850138 missense probably benign 0.04
R3825:Plscr3 UTSW 11 69850138 missense probably benign 0.04
R3919:Plscr3 UTSW 11 69847410 unclassified probably benign
R5047:Plscr3 UTSW 11 69850091 splice site probably null
R6306:Plscr3 UTSW 11 69847646 splice site probably null
R7358:Plscr3 UTSW 11 69847490 missense unknown
Predicted Primers PCR Primer
(F):5'- GGAGCAAGATGGGCTTCATG -3'
(R):5'- TGCCAGCTGTCTTCTGACTG -3'

Sequencing Primer
(F):5'- CAAGATGGGCTTCATGATCTTTATG -3'
(R):5'- TGACTGTTCAGACCCTCAAC -3'
Posted On2018-11-28