Incidental Mutation 'R6972:Git1'
ID542312
Institutional Source Beutler Lab
Gene Symbol Git1
Ensembl Gene ENSMUSG00000011877
Gene NameG protein-coupled receptor kinase-interactor 1
Synonymsp95Cat, Cat-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6972 (G1)
Quality Score153.008
Status Validated
Chromosome11
Chromosomal Location77493562-77507786 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 77499521 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 64 (V64G)
Ref Sequence ENSEMBL: ENSMUSP00000098375 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037285] [ENSMUST00000100812]
Predicted Effect probably damaging
Transcript: ENSMUST00000037285
AA Change: V64G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037210
Gene: ENSMUSG00000011877
AA Change: V64G

DomainStartEndE-ValueType
ArfGap 1 124 1.82e-45 SMART
ANK 132 161 2.55e2 SMART
ANK 166 195 2.47e0 SMART
ANK 199 228 4.6e0 SMART
GIT 273 303 1.01e-10 SMART
GIT 337 367 1.99e-9 SMART
Pfam:GIT_CC 418 483 8.6e-34 PFAM
Pfam:GIT1_C 647 763 3.2e-50 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100812
AA Change: V64G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098375
Gene: ENSMUSG00000011877
AA Change: V64G

DomainStartEndE-ValueType
ArfGap 1 124 1.82e-45 SMART
ANK 132 161 2.55e2 SMART
ANK 166 195 2.47e0 SMART
ANK 199 228 4.6e0 SMART
GIT 264 294 1.01e-10 SMART
GIT 328 358 1.99e-9 SMART
PDB:2W6A|B 417 473 3e-28 PDB
low complexity region 474 484 N/A INTRINSIC
Pfam:GIT1_C 632 756 4.9e-65 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.0%
  • 20x: 95.8%
Validation Efficiency 100% (41/41)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality associated with abnormal lung vascular development with surviving mice exhibiting abnormal learning and anxiety related behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,326,109 Y218N probably damaging Het
Abhd2 A G 7: 79,354,027 S285G probably benign Het
Afg1l T C 10: 42,478,374 T10A probably benign Het
Akap9 A G 5: 4,046,699 N2525D possibly damaging Het
B3gnt7 G A 1: 86,305,387 M1I probably null Het
Bdp1 T C 13: 100,037,761 E2089G probably null Het
Calcrl T G 2: 84,368,578 I156L probably benign Het
Cd69 T C 6: 129,269,580 S122G probably benign Het
Chek2 T C 5: 110,855,839 probably null Het
Ckap5 T A 2: 91,606,313 I1586K probably damaging Het
Cyp4f14 C T 17: 32,905,509 A523T probably benign Het
Dcaf1 T A 9: 106,846,772 C466* probably null Het
Dcdc2a A T 13: 25,120,389 probably benign Het
Eml5 T C 12: 98,876,180 I220V probably benign Het
Etv2 T C 7: 30,634,742 N189D probably benign Het
Fam19a2 A G 10: 123,704,373 T45A probably benign Het
Fuz T C 7: 44,897,331 probably benign Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gpr162 C T 6: 124,861,309 R126H probably damaging Het
Grm5 T C 7: 87,602,923 V127A probably benign Het
Iqsec1 T C 6: 90,676,768 D665G probably damaging Het
Kcnh1 A G 1: 192,276,836 I233V probably damaging Het
Lmcd1 C T 6: 112,310,698 T115I probably damaging Het
Mybpc1 T C 10: 88,560,361 E208G possibly damaging Het
Nfic C A 10: 81,420,357 A158S probably benign Het
Nos3 A T 5: 24,380,243 I798L probably benign Het
Ntrk1 A T 3: 87,783,981 L292Q probably damaging Het
Olfr698 A G 7: 106,752,699 S230P possibly damaging Het
Orc4 T C 2: 48,927,184 Q164R probably benign Het
Pcdhb14 T A 18: 37,449,692 V617E probably damaging Het
Plscr3 G A 11: 69,847,958 E149K probably damaging Het
Pltp A G 2: 164,846,592 probably null Het
Pramef6 A G 4: 143,896,902 L234P probably damaging Het
Prg2 G A 2: 84,982,273 R109H probably benign Het
Ptprj G A 2: 90,580,403 S62F possibly damaging Het
Skint3 T A 4: 112,258,892 S240T probably damaging Het
Smarca5 A G 8: 80,704,751 Y946H probably damaging Het
Taf4b T C 18: 14,813,347 V409A possibly damaging Het
Trim29 T A 9: 43,327,112 N504K probably benign Het
Vmn2r77 T C 7: 86,802,994 Y461H probably damaging Het
Zeb2 T C 2: 44,997,318 K531E probably damaging Het
Zfp687 A G 3: 95,009,377 S813P possibly damaging Het
Other mutations in Git1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Git1 APN 11 77505957 missense probably benign
IGL00401:Git1 APN 11 77498956 splice site probably benign
IGL02143:Git1 APN 11 77505987 missense possibly damaging 0.94
IGL02451:Git1 APN 11 77500687 missense possibly damaging 0.66
IGL02474:Git1 APN 11 77503391 missense probably damaging 1.00
IGL02517:Git1 APN 11 77499587 missense probably benign 0.03
IGL02933:Git1 APN 11 77501076 missense probably damaging 0.98
R0148:Git1 UTSW 11 77505728 missense probably benign 0.28
R0195:Git1 UTSW 11 77501073 missense probably benign 0.07
R0762:Git1 UTSW 11 77499834 missense possibly damaging 0.80
R1439:Git1 UTSW 11 77506418 missense possibly damaging 0.89
R1739:Git1 UTSW 11 77498982 missense probably damaging 1.00
R4471:Git1 UTSW 11 77499824 missense probably benign 0.26
R4482:Git1 UTSW 11 77500507 missense possibly damaging 0.89
R4653:Git1 UTSW 11 77505043 missense possibly damaging 0.94
R4783:Git1 UTSW 11 77499837 missense probably damaging 1.00
R5014:Git1 UTSW 11 77498995 missense probably damaging 1.00
R5703:Git1 UTSW 11 77504668 frame shift probably null
R5984:Git1 UTSW 11 77506483 missense possibly damaging 0.76
R6962:Git1 UTSW 11 77504643 missense probably benign 0.31
R7012:Git1 UTSW 11 77499780 missense probably damaging 1.00
R8204:Git1 UTSW 11 77505335 missense probably benign 0.23
X0028:Git1 UTSW 11 77499046 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAGCAAGCTCTGAAACGTTCTG -3'
(R):5'- TTAGGGAAGAGACCTTTCAGGC -3'

Sequencing Primer
(F):5'- ACGTTCTGAAGCTTGGCGAAC -3'
(R):5'- AGACCTTTCAGGCCCCGTC -3'
Posted On2018-11-28