Incidental Mutation 'R6972:Taf4b'
ID542317
Institutional Source Beutler Lab
Gene Symbol Taf4b
Ensembl Gene ENSMUSG00000054321
Gene NameTATA-box binding protein associated factor 4b
SynonymsTaf2c2, TAFII105, 2610524B04Rik, 105kDa, 4932409F03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.465) question?
Stock #R6972 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location14783245-14900359 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 14813347 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 409 (V409A)
Ref Sequence ENSEMBL: ENSMUSP00000126909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169862]
Predicted Effect possibly damaging
Transcript: ENSMUST00000169862
AA Change: V409A

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000126909
Gene: ENSMUSG00000054321
AA Change: V409A

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
low complexity region 185 196 N/A INTRINSIC
Pfam:TAFH 257 348 5.3e-39 PFAM
low complexity region 359 376 N/A INTRINSIC
low complexity region 412 422 N/A INTRINSIC
Pfam:TAF4 610 852 4e-72 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.0%
  • 20x: 95.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TATA binding protein (TBP) and TBP-associated factors (TAFs) participate in the formation of the TFIID protein complex, which is involved in initiation of transcription of genes by RNA polymerase II. This gene encodes a cell type-specific TAF that may be responsible for mediating transcription by a subset of activators in B cells. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jun 2014]
PHENOTYPE: Homozygotes for a targeted null mutation are infertile due to a granulosa cell defect preventing normal follicle formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,326,109 Y218N probably damaging Het
Abhd2 A G 7: 79,354,027 S285G probably benign Het
Afg1l T C 10: 42,478,374 T10A probably benign Het
Akap9 A G 5: 4,046,699 N2525D possibly damaging Het
B3gnt7 G A 1: 86,305,387 M1I probably null Het
Bdp1 T C 13: 100,037,761 E2089G probably null Het
Calcrl T G 2: 84,368,578 I156L probably benign Het
Cd69 T C 6: 129,269,580 S122G probably benign Het
Chek2 T C 5: 110,855,839 probably null Het
Ckap5 T A 2: 91,606,313 I1586K probably damaging Het
Cyp4f14 C T 17: 32,905,509 A523T probably benign Het
Dcaf1 T A 9: 106,846,772 C466* probably null Het
Dcdc2a A T 13: 25,120,389 probably benign Het
Eml5 T C 12: 98,876,180 I220V probably benign Het
Etv2 T C 7: 30,634,742 N189D probably benign Het
Fam19a2 A G 10: 123,704,373 T45A probably benign Het
Fuz T C 7: 44,897,331 probably benign Het
Git1 T G 11: 77,499,521 V64G probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gpr162 C T 6: 124,861,309 R126H probably damaging Het
Grm5 T C 7: 87,602,923 V127A probably benign Het
Iqsec1 T C 6: 90,676,768 D665G probably damaging Het
Kcnh1 A G 1: 192,276,836 I233V probably damaging Het
Lmcd1 C T 6: 112,310,698 T115I probably damaging Het
Mybpc1 T C 10: 88,560,361 E208G possibly damaging Het
Nfic C A 10: 81,420,357 A158S probably benign Het
Nos3 A T 5: 24,380,243 I798L probably benign Het
Ntrk1 A T 3: 87,783,981 L292Q probably damaging Het
Olfr698 A G 7: 106,752,699 S230P possibly damaging Het
Orc4 T C 2: 48,927,184 Q164R probably benign Het
Pcdhb14 T A 18: 37,449,692 V617E probably damaging Het
Plscr3 G A 11: 69,847,958 E149K probably damaging Het
Pltp A G 2: 164,846,592 probably null Het
Pramef6 A G 4: 143,896,902 L234P probably damaging Het
Prg2 G A 2: 84,982,273 R109H probably benign Het
Ptprj G A 2: 90,580,403 S62F possibly damaging Het
Skint3 T A 4: 112,258,892 S240T probably damaging Het
Smarca5 A G 8: 80,704,751 Y946H probably damaging Het
Trim29 T A 9: 43,327,112 N504K probably benign Het
Vmn2r77 T C 7: 86,802,994 Y461H probably damaging Het
Zeb2 T C 2: 44,997,318 K531E probably damaging Het
Zfp687 A G 3: 95,009,377 S813P possibly damaging Het
Other mutations in Taf4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01658:Taf4b APN 18 14844420 missense probably damaging 1.00
IGL01755:Taf4b APN 18 14897985 missense probably benign
IGL01755:Taf4b APN 18 14897986 missense probably benign 0.13
IGL02049:Taf4b APN 18 14830139 missense probably benign 0.00
IGL02650:Taf4b APN 18 14841983 nonsense probably null
IGL03078:Taf4b APN 18 14813554 missense possibly damaging 0.48
IGL03169:Taf4b APN 18 14821535 missense probably damaging 1.00
IGL03261:Taf4b APN 18 14821528 missense probably benign
adirondack UTSW 18 14804578 missense probably null 0.16
R0266:Taf4b UTSW 18 14813077 splice site probably benign
R0385:Taf4b UTSW 18 14783760 missense probably benign 0.00
R1015:Taf4b UTSW 18 14813098 missense probably damaging 1.00
R1054:Taf4b UTSW 18 14821473 missense probably benign 0.00
R1416:Taf4b UTSW 18 14821427 splice site probably benign
R1435:Taf4b UTSW 18 14807409 missense probably damaging 1.00
R1609:Taf4b UTSW 18 14835881 missense probably damaging 1.00
R1611:Taf4b UTSW 18 14844469 missense probably null 1.00
R1906:Taf4b UTSW 18 14822102 missense probably benign 0.00
R2038:Taf4b UTSW 18 14807399 missense probably damaging 1.00
R2890:Taf4b UTSW 18 14804792 missense probably damaging 1.00
R4527:Taf4b UTSW 18 14821442 missense probably damaging 1.00
R4559:Taf4b UTSW 18 14813526 missense probably damaging 1.00
R4773:Taf4b UTSW 18 14804520 missense probably benign 0.30
R4857:Taf4b UTSW 18 14804578 missense probably null 0.16
R4946:Taf4b UTSW 18 14813542 missense probably damaging 1.00
R4984:Taf4b UTSW 18 14835816 missense probably damaging 1.00
R4994:Taf4b UTSW 18 14898043 missense probably damaging 0.99
R5010:Taf4b UTSW 18 14822172 missense possibly damaging 0.59
R5155:Taf4b UTSW 18 14830095 missense probably benign 0.07
R5874:Taf4b UTSW 18 14804554 missense probably benign
R6079:Taf4b UTSW 18 14822198 missense possibly damaging 0.75
R6303:Taf4b UTSW 18 14807355 missense probably damaging 1.00
R6304:Taf4b UTSW 18 14807355 missense probably damaging 1.00
R6372:Taf4b UTSW 18 14804733 missense probably damaging 1.00
R7538:Taf4b UTSW 18 14813545 missense probably damaging 1.00
R7790:Taf4b UTSW 18 14813274 missense probably damaging 1.00
R8021:Taf4b UTSW 18 14804524 missense probably damaging 1.00
R8072:Taf4b UTSW 18 14821528 missense probably benign
R8075:Taf4b UTSW 18 14783692 missense possibly damaging 0.58
R8145:Taf4b UTSW 18 14830028 missense probably damaging 1.00
R8221:Taf4b UTSW 18 14898049 missense probably damaging 1.00
R8320:Taf4b UTSW 18 14783692 missense possibly damaging 0.58
R8509:Taf4b UTSW 18 14898055 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCCAGAGCTTCATTGAGAAC -3'
(R):5'- ACGCTTCTCCAAAAGTTGCTG -3'

Sequencing Primer
(F):5'- CCAGAGCTTCATTGAGAACTGTGTG -3'
(R):5'- CTCCAAAAGTTGCTGATGGAATAGCC -3'
Posted On2018-11-28