Incidental Mutation 'R6974:Olfr1181'
ID542328
Institutional Source Beutler Lab
Gene Symbol Olfr1181
Ensembl Gene ENSMUSG00000075125
Gene Nameolfactory receptor 1181
SynonymsMOR225-9P, GA_x6K02T2Q125-49911636-49910701
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R6974 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location88420321-88426171 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88423812 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 71 (Y71C)
Ref Sequence ENSEMBL: ENSMUSP00000150939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099823] [ENSMUST00000102619] [ENSMUST00000213190] [ENSMUST00000216121] [ENSMUST00000217320]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099823
AA Change: Y71C

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097411
Gene: ENSMUSG00000075125
AA Change: Y71C

DomainStartEndE-ValueType
Pfam:7tm_4 28 303 1.5e-48 PFAM
Pfam:7tm_1 39 285 6.9e-16 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000102619
AA Change: Y71C

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099679
Gene: ENSMUSG00000075125
AA Change: Y71C

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
Pfam:7tm_1 39 285 7.2e-26 PFAM
Pfam:7tm_4 137 278 3.5e-39 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213190
AA Change: Y71C

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000216121
Predicted Effect probably benign
Transcript: ENSMUST00000217320
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd12b T A 12: 70,159,447 N67K probably benign Het
Amotl1 C A 9: 14,644,920 E37* probably null Het
Ap4b1 C A 3: 103,813,285 Y90* probably null Het
Apc A G 18: 34,298,427 E277G possibly damaging Het
Armc4 A T 18: 7,294,479 Y45N probably benign Het
Atl1 T A 12: 69,926,039 H44Q probably damaging Het
Atp6v0b G A 4: 117,885,667 T74M probably benign Het
Auts2 T C 5: 131,440,599 T627A probably benign Het
B4galnt4 T A 7: 141,067,536 I372N possibly damaging Het
B4galt2 A G 4: 117,873,951 S338P probably damaging Het
Cfap43 A C 19: 47,785,278 probably null Het
Col4a1 T C 8: 11,312,538 probably benign Het
Col7a1 A C 9: 108,969,426 I1741L possibly damaging Het
Coprs A T 8: 13,885,750 S90T probably benign Het
Csrnp3 T C 2: 65,949,064 V40A possibly damaging Het
D11Wsu47e A G 11: 113,687,992 D71G probably benign Het
Ephx1 C A 1: 180,999,722 probably null Het
Erich6 C A 3: 58,618,799 R594L probably benign Het
F2rl2 A T 13: 95,700,530 N28Y probably damaging Het
Fbxo38 A T 18: 62,506,669 N1041K possibly damaging Het
Fcgr2b C T 1: 170,963,408 probably null Het
Fsip2 T A 2: 82,978,717 N1793K probably damaging Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gcnt3 A G 9: 70,034,887 I133T probably damaging Het
Hoxa1 T A 6: 52,158,041 I61F probably damaging Het
Impact C T 18: 12,982,112 L102F probably damaging Het
Ist1 A T 8: 109,677,652 I196N probably damaging Het
Kcnv2 T A 19: 27,333,882 S550T probably benign Het
Krt2 A T 15: 101,817,879 S75T unknown Het
Krtap21-1 A G 16: 89,403,578 S59P unknown Het
Lef1 A T 3: 131,111,574 I35F probably damaging Het
Lpcat2 A C 8: 92,873,079 N225T probably damaging Het
Lztfl1 A T 9: 123,709,584 N142K probably benign Het
Mdh1b G A 1: 63,721,816 H88Y probably benign Het
Mettl26 A G 17: 25,876,684 D171G probably damaging Het
Mrps24 A T 11: 5,704,663 M97K probably benign Het
Ms4a14 A T 19: 11,302,135 C1020S probably benign Het
Mterf1a A T 5: 3,890,854 I338K probably benign Het
Olfr381 A G 11: 73,486,473 I117T probably benign Het
Olfr591 T A 7: 103,173,235 H134L probably damaging Het
Olfr834 T A 9: 18,988,393 I135N probably damaging Het
Paqr3 T A 5: 97,108,287 H76L probably damaging Het
Parp1 T A 1: 180,589,506 Y618* probably null Het
Pilrb2 C T 5: 137,871,787 probably benign Het
Pkm A G 9: 59,668,570 N90D probably damaging Het
Pla2g4c T G 7: 13,344,534 probably null Het
Plppr4 C T 3: 117,323,018 V339I probably damaging Het
Pnkp T A 7: 44,861,038 D304E probably damaging Het
Pnlip T C 19: 58,679,635 probably null Het
Polr2a A G 11: 69,747,200 C148R probably damaging Het
Ppp1r10 G A 17: 35,929,551 G578S probably benign Het
Ptges2 C T 2: 32,397,671 T137I possibly damaging Het
Ptpre T C 7: 135,669,148 V344A possibly damaging Het
Rag1 A G 2: 101,641,792 F1002L probably damaging Het
Rcn2 T A 9: 56,053,014 Y188* probably null Het
Rest A G 5: 77,268,199 S87G probably damaging Het
Rgsl1 C T 1: 153,799,822 D913N probably damaging Het
Scp2 A G 4: 108,071,278 M1T probably null Het
Slamf8 T A 1: 172,588,023 N83Y probably damaging Het
Slc26a11 T A 11: 119,358,018 F75Y possibly damaging Het
Slc26a5 A G 5: 21,840,572 S133P probably damaging Het
Sncb A T 13: 54,762,674 V83E probably damaging Het
Tmem243 A G 5: 9,101,348 T11A probably damaging Het
Trim38 A G 13: 23,789,519 N277D probably benign Het
Vmn1r189 C T 13: 22,102,458 G70S probably damaging Het
Vmn2r-ps117 A G 17: 18,838,233 R684G probably benign Het
Wdr59 T C 8: 111,460,788 N792D possibly damaging Het
Wnt5a A G 14: 28,522,570 D238G possibly damaging Het
Zbtb42 C A 12: 112,680,390 T333K probably damaging Het
Zfp119b A G 17: 55,938,564 S509P probably benign Het
Zfp365 T A 10: 67,909,764 K61N probably damaging Het
Zfp553 T C 7: 127,236,653 F460S probably damaging Het
Zfp788 C T 7: 41,649,877 Q594* probably null Het
Zfp984 T A 4: 147,761,250 M1L possibly damaging Het
Zmiz2 T A 11: 6,397,566 Y291* probably null Het
Other mutations in Olfr1181
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Olfr1181 APN 2 88423786 missense probably benign 0.30
IGL02224:Olfr1181 APN 2 88423708 splice site probably null
IGL03293:Olfr1181 APN 2 88423227 missense probably damaging 1.00
IGL02802:Olfr1181 UTSW 2 88423488 missense probably benign 0.23
R2214:Olfr1181 UTSW 2 88423117 missense probably benign 0.00
R2508:Olfr1181 UTSW 2 88423456 missense possibly damaging 0.95
R4050:Olfr1181 UTSW 2 88423623 missense probably damaging 0.99
R5404:Olfr1181 UTSW 2 88423801 missense probably damaging 0.98
R5727:Olfr1181 UTSW 2 88423447 missense probably benign 0.00
R6578:Olfr1181 UTSW 2 88423144 missense probably benign 0.12
R6663:Olfr1181 UTSW 2 88423350 missense probably benign 0.25
R7042:Olfr1181 UTSW 2 88423402 missense possibly damaging 0.89
R7659:Olfr1181 UTSW 2 88423926 missense probably damaging 1.00
R8443:Olfr1181 UTSW 2 88423401 missense probably benign
X0018:Olfr1181 UTSW 2 88423662 missense probably benign
Z1177:Olfr1181 UTSW 2 88423815 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- ACTAGCATCATAACCTGGGGAAAG -3'
(R):5'- ATGGGGCTATCTTCCAAGCAG -3'

Sequencing Primer
(F):5'- CCATGTAGTAGAGAGGCTTGC -3'
(R):5'- CCAAGCAGAACACTGAAGTATTTTGC -3'
Posted On2018-11-28