Incidental Mutation 'R6974:Plppr4'
ID542332
Institutional Source Beutler Lab
Gene Symbol Plppr4
Ensembl Gene ENSMUSG00000044667
Gene Namephospholipid phosphatase related 4
SynonymsLppr4, D3Bwg0562e
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6974 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location117319139-117360876 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 117323018 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 339 (V339I)
Ref Sequence ENSEMBL: ENSMUSP00000143753 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061071] [ENSMUST00000197743]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061071
AA Change: V397I

PolyPhen 2 Score 0.481 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000052306
Gene: ENSMUSG00000044667
AA Change: V397I

DomainStartEndE-ValueType
acidPPc 180 324 4.07e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000197743
AA Change: V339I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000143753
Gene: ENSMUSG00000044667
AA Change: V339I

DomainStartEndE-ValueType
SCOP:d1d2ta_ 59 268 1e-7 SMART
Blast:acidPPc 180 265 8e-53 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the lipid phosphate phosphatase (LPP) family. LPPs catalyze the dephosphorylation of a number of bioactive lipid mediators that regulate a variety of cell functions. This protein is specifically expressed in neurons. It is located in the membranes of outgrowing axons and has been shown to be important for axonal outgrowth during development and regenerative sprouting. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced body weight, seizures, hyperexcitability of evoked fEPSP, and premature lethality around 3 weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd12b T A 12: 70,159,447 N67K probably benign Het
Amotl1 C A 9: 14,644,920 E37* probably null Het
Ap4b1 C A 3: 103,813,285 Y90* probably null Het
Apc A G 18: 34,298,427 E277G possibly damaging Het
Armc4 A T 18: 7,294,479 Y45N probably benign Het
Atl1 T A 12: 69,926,039 H44Q probably damaging Het
Atp6v0b G A 4: 117,885,667 T74M probably benign Het
Auts2 T C 5: 131,440,599 T627A probably benign Het
B4galnt4 T A 7: 141,067,536 I372N possibly damaging Het
B4galt2 A G 4: 117,873,951 S338P probably damaging Het
Cfap43 A C 19: 47,785,278 probably null Het
Col4a1 T C 8: 11,312,538 probably benign Het
Col7a1 A C 9: 108,969,426 I1741L possibly damaging Het
Coprs A T 8: 13,885,750 S90T probably benign Het
Csrnp3 T C 2: 65,949,064 V40A possibly damaging Het
D11Wsu47e A G 11: 113,687,992 D71G probably benign Het
Ephx1 C A 1: 180,999,722 probably null Het
Erich6 C A 3: 58,618,799 R594L probably benign Het
F2rl2 A T 13: 95,700,530 N28Y probably damaging Het
Fbxo38 A T 18: 62,506,669 N1041K possibly damaging Het
Fcgr2b C T 1: 170,963,408 probably null Het
Fsip2 T A 2: 82,978,717 N1793K probably damaging Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gcnt3 A G 9: 70,034,887 I133T probably damaging Het
Hoxa1 T A 6: 52,158,041 I61F probably damaging Het
Impact C T 18: 12,982,112 L102F probably damaging Het
Ist1 A T 8: 109,677,652 I196N probably damaging Het
Kcnv2 T A 19: 27,333,882 S550T probably benign Het
Krt2 A T 15: 101,817,879 S75T unknown Het
Krtap21-1 A G 16: 89,403,578 S59P unknown Het
Lef1 A T 3: 131,111,574 I35F probably damaging Het
Lpcat2 A C 8: 92,873,079 N225T probably damaging Het
Lztfl1 A T 9: 123,709,584 N142K probably benign Het
Mdh1b G A 1: 63,721,816 H88Y probably benign Het
Mettl26 A G 17: 25,876,684 D171G probably damaging Het
Mrps24 A T 11: 5,704,663 M97K probably benign Het
Ms4a14 A T 19: 11,302,135 C1020S probably benign Het
Mterf1a A T 5: 3,890,854 I338K probably benign Het
Olfr1181 T C 2: 88,423,812 Y71C possibly damaging Het
Olfr381 A G 11: 73,486,473 I117T probably benign Het
Olfr591 T A 7: 103,173,235 H134L probably damaging Het
Olfr834 T A 9: 18,988,393 I135N probably damaging Het
Paqr3 T A 5: 97,108,287 H76L probably damaging Het
Parp1 T A 1: 180,589,506 Y618* probably null Het
Pilrb2 C T 5: 137,871,787 probably benign Het
Pkm A G 9: 59,668,570 N90D probably damaging Het
Pla2g4c T G 7: 13,344,534 probably null Het
Pnkp T A 7: 44,861,038 D304E probably damaging Het
Pnlip T C 19: 58,679,635 probably null Het
Polr2a A G 11: 69,747,200 C148R probably damaging Het
Ppp1r10 G A 17: 35,929,551 G578S probably benign Het
Ptges2 C T 2: 32,397,671 T137I possibly damaging Het
Ptpre T C 7: 135,669,148 V344A possibly damaging Het
Rag1 A G 2: 101,641,792 F1002L probably damaging Het
Rcn2 T A 9: 56,053,014 Y188* probably null Het
Rest A G 5: 77,268,199 S87G probably damaging Het
Rgsl1 C T 1: 153,799,822 D913N probably damaging Het
Scp2 A G 4: 108,071,278 M1T probably null Het
Slamf8 T A 1: 172,588,023 N83Y probably damaging Het
Slc26a11 T A 11: 119,358,018 F75Y possibly damaging Het
Slc26a5 A G 5: 21,840,572 S133P probably damaging Het
Sncb A T 13: 54,762,674 V83E probably damaging Het
Tmem243 A G 5: 9,101,348 T11A probably damaging Het
Trim38 A G 13: 23,789,519 N277D probably benign Het
Vmn1r189 C T 13: 22,102,458 G70S probably damaging Het
Vmn2r-ps117 A G 17: 18,838,233 R684G probably benign Het
Wdr59 T C 8: 111,460,788 N792D possibly damaging Het
Wnt5a A G 14: 28,522,570 D238G possibly damaging Het
Zbtb42 C A 12: 112,680,390 T333K probably damaging Het
Zfp119b A G 17: 55,938,564 S509P probably benign Het
Zfp365 T A 10: 67,909,764 K61N probably damaging Het
Zfp553 T C 7: 127,236,653 F460S probably damaging Het
Zfp788 C T 7: 41,649,877 Q594* probably null Het
Zfp984 T A 4: 147,761,250 M1L possibly damaging Het
Zmiz2 T A 11: 6,397,566 Y291* probably null Het
Other mutations in Plppr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Plppr4 APN 3 117322220 missense probably benign 0.01
IGL01969:Plppr4 APN 3 117328359 missense probably damaging 1.00
IGL02014:Plppr4 APN 3 117335573 missense probably damaging 1.00
IGL02068:Plppr4 APN 3 117331784 splice site probably benign
IGL02426:Plppr4 APN 3 117322295 missense probably benign 0.01
IGL03203:Plppr4 APN 3 117325891 missense possibly damaging 0.89
PIT4445001:Plppr4 UTSW 3 117360308 unclassified probably benign
R0376:Plppr4 UTSW 3 117323091 missense probably benign 0.05
R0755:Plppr4 UTSW 3 117322670 missense possibly damaging 0.68
R0831:Plppr4 UTSW 3 117331646 critical splice donor site probably null
R1518:Plppr4 UTSW 3 117335503 missense probably damaging 1.00
R1523:Plppr4 UTSW 3 117322841 missense probably damaging 1.00
R1581:Plppr4 UTSW 3 117328266 missense possibly damaging 0.58
R1628:Plppr4 UTSW 3 117328272 missense probably damaging 1.00
R2510:Plppr4 UTSW 3 117331706 missense probably damaging 0.99
R2511:Plppr4 UTSW 3 117331706 missense probably damaging 0.99
R4332:Plppr4 UTSW 3 117322825 missense probably benign
R4380:Plppr4 UTSW 3 117322397 missense probably benign 0.40
R4787:Plppr4 UTSW 3 117322330 missense probably damaging 0.99
R4829:Plppr4 UTSW 3 117335591 missense possibly damaging 0.94
R5511:Plppr4 UTSW 3 117325902 missense probably benign 0.39
R5819:Plppr4 UTSW 3 117325864 missense possibly damaging 0.89
R6149:Plppr4 UTSW 3 117322394 missense probably benign 0.22
R6257:Plppr4 UTSW 3 117322579 missense possibly damaging 0.49
R7045:Plppr4 UTSW 3 117360034 missense probably damaging 1.00
R7102:Plppr4 UTSW 3 117323183 missense probably damaging 0.98
R7507:Plppr4 UTSW 3 117322105 missense possibly damaging 0.76
R7820:Plppr4 UTSW 3 117321949 missense possibly damaging 0.88
R8179:Plppr4 UTSW 3 117331678 missense probably damaging 1.00
R8181:Plppr4 UTSW 3 117322465 missense probably damaging 1.00
R8391:Plppr4 UTSW 3 117335411 missense probably benign 0.02
R8531:Plppr4 UTSW 3 117321943 missense probably damaging 1.00
R8762:Plppr4 UTSW 3 117325833 missense probably damaging 1.00
R8784:Plppr4 UTSW 3 117322541 nonsense probably null
R8933:Plppr4 UTSW 3 117323041 missense probably damaging 1.00
Z1176:Plppr4 UTSW 3 117322849 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTGTAGGGACATCTTACGAC -3'
(R):5'- TGCCTAGTGAAGACAGTATGC -3'

Sequencing Primer
(F):5'- GTAGGGACATCTTACGACTCTCATTC -3'
(R):5'- CCTAGTGAAGACAGTATGCTTCAGC -3'
Posted On2018-11-28