Incidental Mutation 'R6974:Ptpre'
ID542352
Institutional Source Beutler Lab
Gene Symbol Ptpre
Ensembl Gene ENSMUSG00000041836
Gene Nameprotein tyrosine phosphatase, receptor type, E
SynonymsPTPe, RPTPepsilon, PTPepsilon
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.602) question?
Stock #R6974 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location135537481-135686293 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 135669148 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 344 (V344A)
Ref Sequence ENSEMBL: ENSMUSP00000147524 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073961] [ENSMUST00000209256] [ENSMUST00000209979] [ENSMUST00000210833] [ENSMUST00000211140] [ENSMUST00000211788]
Predicted Effect possibly damaging
Transcript: ENSMUST00000073961
AA Change: V331A

PolyPhen 2 Score 0.826 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000073616
Gene: ENSMUSG00000041836
AA Change: V331A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 25 36 N/A INTRINSIC
transmembrane domain 48 70 N/A INTRINSIC
PTPc 133 395 4.65e-136 SMART
PTPc 424 690 7.36e-116 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000209256
AA Change: V351A

PolyPhen 2 Score 0.826 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000209979
AA Change: V274A

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000210833
AA Change: V331A

PolyPhen 2 Score 0.826 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000211140
AA Change: V331A

PolyPhen 2 Score 0.826 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000211788
AA Change: V344A

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. Several alternatively spliced transcript variants of this gene have been reported, at least two of which encode a receptor-type PTP that possesses a short extracellular domain, a single transmembrane region, and two tandem intracytoplasmic catalytic domains; another one encodes a PTP that contains a distinct hydrophilic N-terminus, and thus represents a nonreceptor-type isoform of this PTP. Studies of the similar gene in mice suggested the regulatory roles of this PTP in RAS related signal transduction pathways, cytokine-induced SATA signaling, as well as the activation of voltage-gated K+ channels. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early-onset peripheral myelination defects, increased activity of voltage-gated potassium channels in Schwann cells, and increased trabecular bone mass due to cell-specific defects in osteoclast function in young females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd12b T A 12: 70,159,447 N67K probably benign Het
Amotl1 C A 9: 14,644,920 E37* probably null Het
Ap4b1 C A 3: 103,813,285 Y90* probably null Het
Apc A G 18: 34,298,427 E277G possibly damaging Het
Armc4 A T 18: 7,294,479 Y45N probably benign Het
Atl1 T A 12: 69,926,039 H44Q probably damaging Het
Atp6v0b G A 4: 117,885,667 T74M probably benign Het
Auts2 T C 5: 131,440,599 T627A probably benign Het
B4galnt4 T A 7: 141,067,536 I372N possibly damaging Het
B4galt2 A G 4: 117,873,951 S338P probably damaging Het
Cfap43 A C 19: 47,785,278 probably null Het
Col4a1 T C 8: 11,312,538 probably benign Het
Col7a1 A C 9: 108,969,426 I1741L possibly damaging Het
Coprs A T 8: 13,885,750 S90T probably benign Het
Csrnp3 T C 2: 65,949,064 V40A possibly damaging Het
D11Wsu47e A G 11: 113,687,992 D71G probably benign Het
Ephx1 C A 1: 180,999,722 probably null Het
Erich6 C A 3: 58,618,799 R594L probably benign Het
F2rl2 A T 13: 95,700,530 N28Y probably damaging Het
Fbxo38 A T 18: 62,506,669 N1041K possibly damaging Het
Fcgr2b C T 1: 170,963,408 probably null Het
Fsip2 T A 2: 82,978,717 N1793K probably damaging Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gcnt3 A G 9: 70,034,887 I133T probably damaging Het
Hoxa1 T A 6: 52,158,041 I61F probably damaging Het
Impact C T 18: 12,982,112 L102F probably damaging Het
Ist1 A T 8: 109,677,652 I196N probably damaging Het
Kcnv2 T A 19: 27,333,882 S550T probably benign Het
Krt2 A T 15: 101,817,879 S75T unknown Het
Krtap21-1 A G 16: 89,403,578 S59P unknown Het
Lef1 A T 3: 131,111,574 I35F probably damaging Het
Lpcat2 A C 8: 92,873,079 N225T probably damaging Het
Lztfl1 A T 9: 123,709,584 N142K probably benign Het
Mdh1b G A 1: 63,721,816 H88Y probably benign Het
Mettl26 A G 17: 25,876,684 D171G probably damaging Het
Mrps24 A T 11: 5,704,663 M97K probably benign Het
Ms4a14 A T 19: 11,302,135 C1020S probably benign Het
Mterf1a A T 5: 3,890,854 I338K probably benign Het
Olfr1181 T C 2: 88,423,812 Y71C possibly damaging Het
Olfr381 A G 11: 73,486,473 I117T probably benign Het
Olfr591 T A 7: 103,173,235 H134L probably damaging Het
Olfr834 T A 9: 18,988,393 I135N probably damaging Het
Paqr3 T A 5: 97,108,287 H76L probably damaging Het
Parp1 T A 1: 180,589,506 Y618* probably null Het
Pilrb2 C T 5: 137,871,787 probably benign Het
Pkm A G 9: 59,668,570 N90D probably damaging Het
Pla2g4c T G 7: 13,344,534 probably null Het
Plppr4 C T 3: 117,323,018 V339I probably damaging Het
Pnkp T A 7: 44,861,038 D304E probably damaging Het
Pnlip T C 19: 58,679,635 probably null Het
Polr2a A G 11: 69,747,200 C148R probably damaging Het
Ppp1r10 G A 17: 35,929,551 G578S probably benign Het
Ptges2 C T 2: 32,397,671 T137I possibly damaging Het
Rag1 A G 2: 101,641,792 F1002L probably damaging Het
Rcn2 T A 9: 56,053,014 Y188* probably null Het
Rest A G 5: 77,268,199 S87G probably damaging Het
Rgsl1 C T 1: 153,799,822 D913N probably damaging Het
Scp2 A G 4: 108,071,278 M1T probably null Het
Slamf8 T A 1: 172,588,023 N83Y probably damaging Het
Slc26a11 T A 11: 119,358,018 F75Y possibly damaging Het
Slc26a5 A G 5: 21,840,572 S133P probably damaging Het
Sncb A T 13: 54,762,674 V83E probably damaging Het
Tmem243 A G 5: 9,101,348 T11A probably damaging Het
Trim38 A G 13: 23,789,519 N277D probably benign Het
Vmn1r189 C T 13: 22,102,458 G70S probably damaging Het
Vmn2r-ps117 A G 17: 18,838,233 R684G probably benign Het
Wdr59 T C 8: 111,460,788 N792D possibly damaging Het
Wnt5a A G 14: 28,522,570 D238G possibly damaging Het
Zbtb42 C A 12: 112,680,390 T333K probably damaging Het
Zfp119b A G 17: 55,938,564 S509P probably benign Het
Zfp365 T A 10: 67,909,764 K61N probably damaging Het
Zfp553 T C 7: 127,236,653 F460S probably damaging Het
Zfp788 C T 7: 41,649,877 Q594* probably null Het
Zfp984 T A 4: 147,761,250 M1L possibly damaging Het
Zmiz2 T A 11: 6,397,566 Y291* probably null Het
Other mutations in Ptpre
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00918:Ptpre APN 7 135659053 missense probably damaging 0.98
IGL01019:Ptpre APN 7 135678325 nonsense probably null
IGL01115:Ptpre APN 7 135670764 missense probably damaging 1.00
IGL01456:Ptpre APN 7 135669802 missense probably damaging 1.00
IGL01516:Ptpre APN 7 135664999 missense probably damaging 0.97
IGL02108:Ptpre APN 7 135659102 missense possibly damaging 0.85
IGL02735:Ptpre APN 7 135667567 missense probably damaging 1.00
IGL03326:Ptpre APN 7 135672817 missense probably damaging 1.00
IGL03327:Ptpre APN 7 135672822 critical splice donor site probably null
R0183:Ptpre UTSW 7 135669845 missense probably benign 0.01
R0369:Ptpre UTSW 7 135670715 missense probably damaging 1.00
R0538:Ptpre UTSW 7 135663315 missense probably damaging 0.99
R0762:Ptpre UTSW 7 135679235 missense probably damaging 0.99
R1169:Ptpre UTSW 7 135667612 missense probably benign 0.33
R1214:Ptpre UTSW 7 135679258 missense probably damaging 1.00
R1629:Ptpre UTSW 7 135669799 missense probably damaging 1.00
R1654:Ptpre UTSW 7 135653928 missense probably benign 0.32
R1819:Ptpre UTSW 7 135668993 splice site probably benign
R1876:Ptpre UTSW 7 135678317 missense possibly damaging 0.73
R2049:Ptpre UTSW 7 135670695 splice site probably benign
R2284:Ptpre UTSW 7 135669781 missense probably benign 0.05
R2895:Ptpre UTSW 7 135643858 nonsense probably null
R4508:Ptpre UTSW 7 135669103 missense probably damaging 1.00
R4603:Ptpre UTSW 7 135667643 nonsense probably null
R4644:Ptpre UTSW 7 135651932 intron probably benign
R4863:Ptpre UTSW 7 135669132 missense probably benign 0.00
R4989:Ptpre UTSW 7 135669132 missense probably benign 0.00
R5015:Ptpre UTSW 7 135669132 missense probably benign 0.00
R5133:Ptpre UTSW 7 135669132 missense probably benign 0.00
R5134:Ptpre UTSW 7 135652092 missense probably damaging 0.96
R5291:Ptpre UTSW 7 135678301 missense probably benign
R5372:Ptpre UTSW 7 135653940 missense possibly damaging 0.87
R5653:Ptpre UTSW 7 135653943 missense probably damaging 0.99
R5896:Ptpre UTSW 7 135674278 missense probably benign 0.39
R6238:Ptpre UTSW 7 135671180 missense probably damaging 1.00
R7125:Ptpre UTSW 7 135654015 nonsense probably null
R7298:Ptpre UTSW 7 135683287 missense probably damaging 1.00
R7453:Ptpre UTSW 7 135538074 missense unknown
R7459:Ptpre UTSW 7 135667600 missense probably benign
R7855:Ptpre UTSW 7 135651995 missense probably benign
R7938:Ptpre UTSW 7 135651995 missense probably benign
R8003:Ptpre UTSW 7 135669036 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GAGATGCTAAACAGTTCCACCTCC -3'
(R):5'- GCCTTGTCAGCCTTCAAGAG -3'

Sequencing Primer
(F):5'- TAAACAGTTCCACCTCCCATCTC -3'
(R):5'- GCCTTCAAGAGTTTTACATATTGGG -3'
Posted On2018-11-28