Incidental Mutation 'R6974:Armc4'
ID542387
Institutional Source Beutler Lab
Gene Symbol Armc4
Ensembl Gene ENSMUSG00000061802
Gene Namearmadillo repeat containing 4
Synonymsb2b643Clo, 4930463I21Rik, b2b227.1Clo
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.227) question?
Stock #R6974 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location7088233-7297901 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 7294479 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 45 (Y45N)
Ref Sequence ENSEMBL: ENSMUSP00000080028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081275]
Predicted Effect probably benign
Transcript: ENSMUST00000081275
AA Change: Y45N

PolyPhen 2 Score 0.369 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000080028
Gene: ENSMUSG00000061802
AA Change: Y45N

DomainStartEndE-ValueType
low complexity region 172 186 N/A INTRINSIC
low complexity region 410 428 N/A INTRINSIC
ARM 475 516 1.38e1 SMART
ARM 517 557 2.38e-2 SMART
ARM 558 613 3.97e0 SMART
ARM 614 654 2.59e-3 SMART
ARM 655 695 3.48e1 SMART
ARM 696 737 1.6e1 SMART
ARM 738 778 4.09e0 SMART
ARM 779 819 9.68e0 SMART
ARM 861 903 3.52e0 SMART
ARM 904 944 1.26e1 SMART
ARM 945 985 1.03e1 SMART
ARM 986 1026 1.13e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains ten Armadillo repeat motifs (ARMs) and one HEAT repeat, and is thought to be involved in ciliary and flagellar movement. This protein has been shown to localize to the ciliary axonemes and at the ciliary base of respiratory cells. Studies indicate that mutations in this gene cause partial outer dynein arm (ODA) defects in respiratory cilia. The cilia of cells with mutations in this gene displayed either reduced ciliary beat frequency and amplitude, or, complete immotility. Some individuals with primary ciliary dyskensia (PCD) have been shown to have mutations in this gene. PCD is characterized by chronic airway disease and left/right body asymmetry defects. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for ENU-induced mutations exhibit situs inversus totalis or heterotaxia with congenital heart disease including double outlet right ventricle and ventricular septal defects. Dyskinetic, slow, or immotile airway cilia are also observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd12b T A 12: 70,159,447 N67K probably benign Het
Amotl1 C A 9: 14,644,920 E37* probably null Het
Ap4b1 C A 3: 103,813,285 Y90* probably null Het
Apc A G 18: 34,298,427 E277G possibly damaging Het
Atl1 T A 12: 69,926,039 H44Q probably damaging Het
Atp6v0b G A 4: 117,885,667 T74M probably benign Het
Auts2 T C 5: 131,440,599 T627A probably benign Het
B4galnt4 T A 7: 141,067,536 I372N possibly damaging Het
B4galt2 A G 4: 117,873,951 S338P probably damaging Het
Cfap43 A C 19: 47,785,278 probably null Het
Col4a1 T C 8: 11,312,538 probably benign Het
Col7a1 A C 9: 108,969,426 I1741L possibly damaging Het
Coprs A T 8: 13,885,750 S90T probably benign Het
Csrnp3 T C 2: 65,949,064 V40A possibly damaging Het
D11Wsu47e A G 11: 113,687,992 D71G probably benign Het
Ephx1 C A 1: 180,999,722 probably null Het
Erich6 C A 3: 58,618,799 R594L probably benign Het
F2rl2 A T 13: 95,700,530 N28Y probably damaging Het
Fbxo38 A T 18: 62,506,669 N1041K possibly damaging Het
Fcgr2b C T 1: 170,963,408 probably null Het
Fsip2 T A 2: 82,978,717 N1793K probably damaging Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gcnt3 A G 9: 70,034,887 I133T probably damaging Het
Hoxa1 T A 6: 52,158,041 I61F probably damaging Het
Impact C T 18: 12,982,112 L102F probably damaging Het
Ist1 A T 8: 109,677,652 I196N probably damaging Het
Kcnv2 T A 19: 27,333,882 S550T probably benign Het
Krt2 A T 15: 101,817,879 S75T unknown Het
Krtap21-1 A G 16: 89,403,578 S59P unknown Het
Lef1 A T 3: 131,111,574 I35F probably damaging Het
Lpcat2 A C 8: 92,873,079 N225T probably damaging Het
Lztfl1 A T 9: 123,709,584 N142K probably benign Het
Mdh1b G A 1: 63,721,816 H88Y probably benign Het
Mettl26 A G 17: 25,876,684 D171G probably damaging Het
Mrps24 A T 11: 5,704,663 M97K probably benign Het
Ms4a14 A T 19: 11,302,135 C1020S probably benign Het
Mterf1a A T 5: 3,890,854 I338K probably benign Het
Olfr1181 T C 2: 88,423,812 Y71C possibly damaging Het
Olfr381 A G 11: 73,486,473 I117T probably benign Het
Olfr591 T A 7: 103,173,235 H134L probably damaging Het
Olfr834 T A 9: 18,988,393 I135N probably damaging Het
Paqr3 T A 5: 97,108,287 H76L probably damaging Het
Parp1 T A 1: 180,589,506 Y618* probably null Het
Pilrb2 C T 5: 137,871,787 probably benign Het
Pkm A G 9: 59,668,570 N90D probably damaging Het
Pla2g4c T G 7: 13,344,534 probably null Het
Plppr4 C T 3: 117,323,018 V339I probably damaging Het
Pnkp T A 7: 44,861,038 D304E probably damaging Het
Pnlip T C 19: 58,679,635 probably null Het
Polr2a A G 11: 69,747,200 C148R probably damaging Het
Ppp1r10 G A 17: 35,929,551 G578S probably benign Het
Ptges2 C T 2: 32,397,671 T137I possibly damaging Het
Ptpre T C 7: 135,669,148 V344A possibly damaging Het
Rag1 A G 2: 101,641,792 F1002L probably damaging Het
Rcn2 T A 9: 56,053,014 Y188* probably null Het
Rest A G 5: 77,268,199 S87G probably damaging Het
Rgsl1 C T 1: 153,799,822 D913N probably damaging Het
Scp2 A G 4: 108,071,278 M1T probably null Het
Slamf8 T A 1: 172,588,023 N83Y probably damaging Het
Slc26a11 T A 11: 119,358,018 F75Y possibly damaging Het
Slc26a5 A G 5: 21,840,572 S133P probably damaging Het
Sncb A T 13: 54,762,674 V83E probably damaging Het
Tmem243 A G 5: 9,101,348 T11A probably damaging Het
Trim38 A G 13: 23,789,519 N277D probably benign Het
Vmn1r189 C T 13: 22,102,458 G70S probably damaging Het
Vmn2r-ps117 A G 17: 18,838,233 R684G probably benign Het
Wdr59 T C 8: 111,460,788 N792D possibly damaging Het
Wnt5a A G 14: 28,522,570 D238G possibly damaging Het
Zbtb42 C A 12: 112,680,390 T333K probably damaging Het
Zfp119b A G 17: 55,938,564 S509P probably benign Het
Zfp365 T A 10: 67,909,764 K61N probably damaging Het
Zfp553 T C 7: 127,236,653 F460S probably damaging Het
Zfp788 C T 7: 41,649,877 Q594* probably null Het
Zfp984 T A 4: 147,761,250 M1L possibly damaging Het
Zmiz2 T A 11: 6,397,566 Y291* probably null Het
Other mutations in Armc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00693:Armc4 APN 18 7211504 missense probably damaging 0.96
IGL00822:Armc4 APN 18 7181817 missense probably damaging 1.00
IGL01345:Armc4 APN 18 7266947 missense probably benign 0.00
IGL01593:Armc4 APN 18 7127345 missense probably benign 0.00
IGL01645:Armc4 APN 18 7268491 missense probably benign 0.00
IGL01863:Armc4 APN 18 7222617 missense probably damaging 1.00
IGL01955:Armc4 APN 18 7127291 missense possibly damaging 0.89
IGL02013:Armc4 APN 18 7265157 splice site probably benign
IGL02142:Armc4 APN 18 7214601 missense probably damaging 1.00
IGL02399:Armc4 APN 18 7285719 missense probably benign
IGL02439:Armc4 APN 18 7268444 missense probably benign 0.04
IGL02452:Armc4 APN 18 7129461 missense probably damaging 1.00
IGL02632:Armc4 APN 18 7214727 splice site probably benign
IGL03344:Armc4 APN 18 7129434 nonsense probably null
R0062:Armc4 UTSW 18 7129593 splice site probably benign
R0062:Armc4 UTSW 18 7129593 splice site probably benign
R0242:Armc4 UTSW 18 7211516 missense probably damaging 0.96
R0242:Armc4 UTSW 18 7211516 missense probably damaging 0.96
R0365:Armc4 UTSW 18 7217800 missense probably benign 0.01
R0377:Armc4 UTSW 18 7127415 missense probably benign 0.04
R0466:Armc4 UTSW 18 7286758 missense probably benign 0.10
R0517:Armc4 UTSW 18 7223621 missense probably damaging 1.00
R0521:Armc4 UTSW 18 7222676 missense possibly damaging 0.64
R0841:Armc4 UTSW 18 7268436 missense probably damaging 0.99
R1145:Armc4 UTSW 18 7268436 missense probably damaging 0.99
R1145:Armc4 UTSW 18 7268436 missense probably damaging 0.99
R1435:Armc4 UTSW 18 7222646 missense probably benign 0.01
R1487:Armc4 UTSW 18 7273245 missense probably damaging 0.98
R1634:Armc4 UTSW 18 7286688 missense probably damaging 0.99
R1677:Armc4 UTSW 18 7222554 missense probably benign 0.01
R1778:Armc4 UTSW 18 7127388 missense probably damaging 1.00
R1792:Armc4 UTSW 18 7286743 missense probably benign 0.00
R1809:Armc4 UTSW 18 7211630 missense probably benign 0.08
R1842:Armc4 UTSW 18 7223551 missense probably benign 0.04
R2144:Armc4 UTSW 18 7127229 missense probably damaging 0.96
R2206:Armc4 UTSW 18 7223676 missense probably benign 0.25
R2273:Armc4 UTSW 18 7223676 missense probably benign 0.25
R2275:Armc4 UTSW 18 7223676 missense probably benign 0.25
R2918:Armc4 UTSW 18 7222625 missense probably benign 0.04
R3421:Armc4 UTSW 18 7223523 splice site probably benign
R3422:Armc4 UTSW 18 7223523 splice site probably benign
R4165:Armc4 UTSW 18 7217008 missense probably damaging 1.00
R4225:Armc4 UTSW 18 7181732 critical splice donor site probably null
R4660:Armc4 UTSW 18 7211609 missense possibly damaging 0.88
R4745:Armc4 UTSW 18 7286763 missense probably benign 0.28
R4812:Armc4 UTSW 18 7288634 missense possibly damaging 0.79
R4831:Armc4 UTSW 18 7222564 missense possibly damaging 0.79
R4923:Armc4 UTSW 18 7181787 missense probably damaging 0.97
R4995:Armc4 UTSW 18 7223663 missense probably damaging 1.00
R5024:Armc4 UTSW 18 7088555 missense probably benign 0.02
R5335:Armc4 UTSW 18 7294566 missense probably benign 0.06
R5434:Armc4 UTSW 18 7222550 missense probably benign 0.03
R5552:Armc4 UTSW 18 7285360 missense possibly damaging 0.51
R5719:Armc4 UTSW 18 7211496 missense probably benign 0.00
R5736:Armc4 UTSW 18 7268416 missense probably benign 0.01
R5792:Armc4 UTSW 18 7217965 missense probably benign 0.00
R5848:Armc4 UTSW 18 7268507 splice site probably null
R5957:Armc4 UTSW 18 7285706 missense probably benign 0.01
R6001:Armc4 UTSW 18 7286838 missense probably benign 0.03
R6309:Armc4 UTSW 18 7214617 missense probably benign 0.04
R6559:Armc4 UTSW 18 7223664 missense probably damaging 0.99
R6574:Armc4 UTSW 18 7129394 splice site probably null
R6581:Armc4 UTSW 18 7129560 missense possibly damaging 0.77
R6736:Armc4 UTSW 18 7223586 missense probably damaging 0.98
R6842:Armc4 UTSW 18 7268401 missense probably benign 0.00
R6968:Armc4 UTSW 18 7273155 splice site probably null
R7024:Armc4 UTSW 18 7211593 missense probably benign 0.43
R7299:Armc4 UTSW 18 7222635 missense probably damaging 1.00
R7578:Armc4 UTSW 18 7211593 missense probably benign 0.43
R7737:Armc4 UTSW 18 7217890 missense probably damaging 1.00
R7878:Armc4 UTSW 18 7217801 missense probably benign 0.01
R8025:Armc4 UTSW 18 7127224 missense probably benign 0.43
R8151:Armc4 UTSW 18 7127358 missense probably damaging 1.00
Z1088:Armc4 UTSW 18 7266919 missense probably benign
Z1176:Armc4 UTSW 18 7129487 missense probably damaging 1.00
Z1176:Armc4 UTSW 18 7216973 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCTATGTATCTCCACTTTGCAACAAG -3'
(R):5'- TCATGTGAAAATGTGGATGCCTC -3'

Sequencing Primer
(F):5'- CTCCACTTTGCAACAAGTTTAGGAC -3'
(R):5'- GTGAAAATGTGGATGCCTCTAACTC -3'
Posted On2018-11-28