Incidental Mutation 'R6975:Pms1'
ID 542396
Institutional Source Beutler Lab
Gene Symbol Pms1
Ensembl Gene ENSMUSG00000026098
Gene Name PMS1 homolog 1, mismatch repair system component
Synonyms
MMRRC Submission 045085-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6975 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 53228346-53336177 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 53228590 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 886 (I886N)
Ref Sequence ENSEMBL: ENSMUSP00000027267 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027267] [ENSMUST00000072235] [ENSMUST00000190748]
AlphaFold Q8K119
Predicted Effect probably damaging
Transcript: ENSMUST00000027267
AA Change: I886N

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000027267
Gene: ENSMUSG00000026098
AA Change: I886N

DomainStartEndE-ValueType
HATPase_c 16 151 3.84e-1 SMART
DNA_mis_repair 210 338 2.46e-25 SMART
low complexity region 457 474 N/A INTRINSIC
HMG 557 627 1.42e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000072235
SMART Domains Protein: ENSMUSP00000072089
Gene: ENSMUSG00000060715

DomainStartEndE-ValueType
coiled coil region 38 68 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190748
SMART Domains Protein: ENSMUSP00000139938
Gene: ENSMUSG00000060715

DomainStartEndE-ValueType
coiled coil region 38 68 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.9%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the DNA mismatch repair mutL/hexB family. This protein is thought to be involved in the repair of DNA mismatches, and it can form heterodimers with MLH1, a known DNA mismatch repair protein. Mutations in this gene cause hereditary nonpolyposis colorectal cancer type 3 (HNPCC3) either alone or in combination with mutations in other genes involved in the HNPCC phenotype, which is also known as Lynch syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit a modest increase in DNA mismatch repair errors, primarily single base pair substitutions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,056,687 (GRCm39) H100L probably benign Het
Apaf1 A T 10: 90,856,596 (GRCm39) H870Q probably damaging Het
Aplf T C 6: 87,623,068 (GRCm39) D358G probably damaging Het
Atp10a A T 7: 58,423,733 (GRCm39) S233C probably damaging Het
Ccdc158 A T 5: 92,814,579 (GRCm39) Y82* probably null Het
Clba1 C T 12: 112,773,217 (GRCm39) P70L possibly damaging Het
Cubn T C 2: 13,491,600 (GRCm39) D149G probably damaging Het
Cyp4f14 T C 17: 33,133,608 (GRCm39) T83A probably benign Het
Endog A G 2: 30,061,648 (GRCm39) probably benign Het
Extl3 T C 14: 65,304,246 (GRCm39) E721G probably benign Het
Gatad1 T C 5: 3,693,540 (GRCm39) R210G probably benign Het
Gcn1 A G 5: 115,751,518 (GRCm39) H2033R probably damaging Het
Gm12830 T C 4: 114,702,246 (GRCm39) M136T Het
Gm6871 T C 7: 41,196,202 (GRCm39) silent Het
Hoxc4 T C 15: 102,944,098 (GRCm39) S159P probably damaging Het
Ift70a2 T C 2: 75,806,752 (GRCm39) R587G probably damaging Het
Ift70a2 A T 2: 75,808,004 (GRCm39) Y169* probably null Het
Igf2bp2 T A 16: 21,880,611 (GRCm39) Q494L probably null Het
Igfn1 T A 1: 135,896,183 (GRCm39) N1461I probably damaging Het
Il23r C A 6: 67,400,352 (GRCm39) K659N probably damaging Het
Map3k11 A G 19: 5,740,755 (GRCm39) S161G possibly damaging Het
Naip6 T A 13: 100,452,773 (GRCm39) Q96L probably damaging Het
Nup133 T C 8: 124,642,057 (GRCm39) E802G probably damaging Het
Nutm1 G A 2: 112,086,563 (GRCm39) S56F probably damaging Het
Or10x4 T A 1: 174,219,243 (GRCm39) S203T probably benign Het
Or51a24 T C 7: 103,734,002 (GRCm39) N95S probably benign Het
Otop2 A T 11: 115,220,152 (GRCm39) S331C possibly damaging Het
Pira1 C G 7: 3,740,319 (GRCm39) A301P probably damaging Het
Pkd1l3 A G 8: 110,387,539 (GRCm39) R1818G possibly damaging Het
Pnpla6 A G 8: 3,588,068 (GRCm39) Y1107C probably damaging Het
Ppp3ca A G 3: 136,611,062 (GRCm39) T362A probably damaging Het
Rarb A G 14: 16,574,942 (GRCm38) S25P possibly damaging Het
Rnf121 A T 7: 101,673,218 (GRCm39) probably null Het
Sae1 T C 7: 16,070,712 (GRCm39) Y266C probably damaging Het
Scpep1 A T 11: 88,838,031 (GRCm39) F85L probably damaging Het
Shank1 T A 7: 43,962,530 (GRCm39) probably null Het
Slc40a1 T C 1: 45,948,652 (GRCm39) K543E probably benign Het
Slc9a9 A G 9: 94,842,499 (GRCm39) Y350C probably damaging Het
Sun2 G T 15: 79,618,420 (GRCm39) Y246* probably null Het
Tas1r2 T A 4: 139,397,031 (GRCm39) I790N probably damaging Het
Tmtc2 T C 10: 105,158,863 (GRCm39) T577A probably benign Het
Trim24 T G 6: 37,896,427 (GRCm39) probably null Het
Ttc12 A G 9: 49,349,718 (GRCm39) V693A probably benign Het
Zbtb22 A C 17: 34,136,938 (GRCm39) D361A probably damaging Het
Zfp276 T A 8: 123,983,570 (GRCm39) C324* probably null Het
Zfp536 A G 7: 37,267,952 (GRCm39) L488P probably damaging Het
Other mutations in Pms1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Pms1 APN 1 53,245,715 (GRCm39) splice site probably benign
IGL00937:Pms1 APN 1 53,314,410 (GRCm39) missense possibly damaging 0.74
IGL01505:Pms1 APN 1 53,246,130 (GRCm39) missense probably benign
IGL02109:Pms1 APN 1 53,246,568 (GRCm39) missense probably damaging 0.96
IGL02245:Pms1 APN 1 53,246,519 (GRCm39) missense probably damaging 1.00
IGL02273:Pms1 APN 1 53,247,156 (GRCm39) missense probably damaging 1.00
IGL02339:Pms1 APN 1 53,314,324 (GRCm39) missense possibly damaging 0.78
R0157:Pms1 UTSW 1 53,234,196 (GRCm39) nonsense probably null
R0530:Pms1 UTSW 1 53,235,972 (GRCm39) splice site probably null
R1398:Pms1 UTSW 1 53,246,435 (GRCm39) missense possibly damaging 0.88
R1817:Pms1 UTSW 1 53,246,128 (GRCm39) missense probably benign 0.02
R1831:Pms1 UTSW 1 53,246,370 (GRCm39) missense probably benign 0.00
R1838:Pms1 UTSW 1 53,231,257 (GRCm39) critical splice donor site probably null
R1867:Pms1 UTSW 1 53,228,546 (GRCm39) missense probably benign 0.36
R1874:Pms1 UTSW 1 53,246,392 (GRCm39) missense probably benign 0.16
R1939:Pms1 UTSW 1 53,236,135 (GRCm39) missense probably damaging 1.00
R1991:Pms1 UTSW 1 53,321,201 (GRCm39) missense probably damaging 1.00
R1993:Pms1 UTSW 1 53,234,174 (GRCm39) missense probably benign
R1995:Pms1 UTSW 1 53,234,174 (GRCm39) missense probably benign
R2049:Pms1 UTSW 1 53,321,147 (GRCm39) missense probably damaging 0.99
R2058:Pms1 UTSW 1 53,314,327 (GRCm39) missense probably benign 0.00
R2140:Pms1 UTSW 1 53,321,147 (GRCm39) missense probably damaging 0.99
R4078:Pms1 UTSW 1 53,306,948 (GRCm39) splice site probably null
R4608:Pms1 UTSW 1 53,234,097 (GRCm39) missense possibly damaging 0.80
R4668:Pms1 UTSW 1 53,228,633 (GRCm39) nonsense probably null
R5164:Pms1 UTSW 1 53,246,799 (GRCm39) missense probably damaging 0.99
R5200:Pms1 UTSW 1 53,245,916 (GRCm39) missense probably benign 0.00
R5397:Pms1 UTSW 1 53,231,279 (GRCm39) nonsense probably null
R5745:Pms1 UTSW 1 53,246,861 (GRCm39) nonsense probably null
R6440:Pms1 UTSW 1 53,234,180 (GRCm39) missense probably damaging 0.98
R6445:Pms1 UTSW 1 53,231,353 (GRCm39) missense possibly damaging 0.77
R6802:Pms1 UTSW 1 53,245,951 (GRCm39) missense probably benign 0.06
R7020:Pms1 UTSW 1 53,228,541 (GRCm39) missense probably damaging 1.00
R7037:Pms1 UTSW 1 53,246,770 (GRCm39) missense possibly damaging 0.95
R7199:Pms1 UTSW 1 53,295,889 (GRCm39) missense probably benign 0.02
R7417:Pms1 UTSW 1 53,236,231 (GRCm39) missense probably benign 0.00
R7587:Pms1 UTSW 1 53,246,475 (GRCm39) missense probably benign 0.00
R7716:Pms1 UTSW 1 53,246,767 (GRCm39) missense probably damaging 1.00
R8178:Pms1 UTSW 1 53,246,505 (GRCm39) missense probably benign 0.00
R8336:Pms1 UTSW 1 53,245,985 (GRCm39) missense probably benign
R8399:Pms1 UTSW 1 53,307,091 (GRCm39) critical splice acceptor site probably null
R8692:Pms1 UTSW 1 53,246,052 (GRCm39) missense probably benign
R8736:Pms1 UTSW 1 53,307,053 (GRCm39) missense possibly damaging 0.63
R8738:Pms1 UTSW 1 53,321,195 (GRCm39) missense possibly damaging 0.67
R8751:Pms1 UTSW 1 53,231,269 (GRCm39) missense probably benign 0.01
R9102:Pms1 UTSW 1 53,307,021 (GRCm39) missense probably benign 0.11
R9294:Pms1 UTSW 1 53,247,216 (GRCm39) missense probably benign
R9648:Pms1 UTSW 1 53,314,284 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGAAGGTTGGACGTGAAAAC -3'
(R):5'- AGTTCTGTTGCCAATGACTTTG -3'

Sequencing Primer
(F):5'- GAACCACATCAGTTTCCAT -3'
(R):5'- GTCTCCATAATGTGCAGCATTG -3'
Posted On 2018-11-28