Mutagenetix > Incidental Mutation

Incidental Mutation 'R6975:Pms1'

542396

Institutional Source

Beutler Lab

Gene Symbol

Pms1

Ensembl Gene

ENSMUSG00000026098

Gene Name

PMS1 homolog 1, mismatch repair system component

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6975 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

53189187-53297018 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 53189431 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 886 (I886N)

Ref Sequence

ENSEMBL: ENSMUSP00000027267 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027267] [ENSMUST00000072235] [ENSMUST00000190748]

AlphaFold

Q8K119

Predicted Effect

probably damaging
Transcript: ENSMUST00000027267
AA Change: I886N

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000027267
Gene: ENSMUSG00000026098
AA Change: I886N

Domain	Start	End	E-Value	Type
HATPase_c	16	151	3.84e-1	SMART
DNA_mis_repair	210	338	2.46e-25	SMART
low complexity region	457	474	N/A	INTRINSIC
HMG	557	627	1.42e-17	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000072235

SMART Domains

Protein: ENSMUSP00000072089
Gene: ENSMUSG00000060715

Domain	Start	End	E-Value	Type
coiled coil region	38	68	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000190748

SMART Domains

Protein: ENSMUSP00000139938
Gene: ENSMUSG00000060715

Domain	Start	End	E-Value	Type
coiled coil region	38	68	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 96.9%

Validation Efficiency

100% (46/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the DNA mismatch repair mutL/hexB family. This protein is thought to be involved in the repair of DNA mismatches, and it can form heterodimers with MLH1, a known DNA mismatch repair protein. Mutations in this gene cause hereditary nonpolyposis colorectal cancer type 3 (HNPCC3) either alone or in combination with mutations in other genes involved in the HNPCC phenotype, which is also known as Lynch syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit a modest increase in DNA mismatch repair errors, primarily single base pair substitutions. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010315B03Rik	T	A	9: 124,294,057	H100L	probably benign	Het
Apaf1	A	T	10: 91,020,734	H870Q	probably damaging	Het
Aplf	T	C	6: 87,646,086	D358G	probably damaging	Het
Atp10a	A	T	7: 58,773,985	S233C	probably damaging	Het
BC022687	C	T	12: 112,809,597	P70L	possibly damaging	Het
Ccdc158	A	T	5: 92,666,720	Y82*	probably null	Het
Cubn	T	C	2: 13,486,789	D149G	probably damaging	Het
Cyp4f14	T	C	17: 32,914,634	T83A	probably benign	Het
Endog	A	G	2: 30,171,636		probably benign	Het
Extl3	T	C	14: 65,066,797	E721G	probably benign	Het
Gatad1	T	C	5: 3,643,540	R210G	probably benign	Het
Gcn1l1	A	G	5: 115,613,459	H2033R	probably damaging	Het
Gm12830	T	C	4: 114,845,049	M136T		Het
Gm15922	C	G	7: 3,737,320	A301P	probably damaging	Het
Gm6871	T	C	7: 41,546,778		silent	Het
Hoxc4	T	C	15: 103,035,672	S159P	probably damaging	Het
Igf2bp2	T	A	16: 22,061,861	Q494L	probably null	Het
Igfn1	T	A	1: 135,968,445	N1461I	probably damaging	Het
Il23r	C	A	6: 67,423,368	K659N	probably damaging	Het
Map3k11	A	G	19: 5,690,727	S161G	possibly damaging	Het
Naip6	T	A	13: 100,316,265	Q96L	probably damaging	Het
Nup133	T	C	8: 123,915,318	E802G	probably damaging	Het
Nutm1	G	A	2: 112,256,218	S56F	probably damaging	Het
Olfr248	T	A	1: 174,391,677	S203T	probably benign	Het
Olfr645	T	C	7: 104,084,795	N95S	probably benign	Het
Otop2	A	T	11: 115,329,326	S331C	possibly damaging	Het
Pkd1l3	A	G	8: 109,660,907	R1818G	possibly damaging	Het
Pnpla6	A	G	8: 3,538,068	Y1107C	probably damaging	Het
Ppp3ca	A	G	3: 136,905,301	T362A	probably damaging	Het
Rarb	A	G	14: 16,574,942	S25P	possibly damaging	Het
Rnf121	A	T	7: 102,024,011		probably null	Het
Sae1	T	C	7: 16,336,787	Y266C	probably damaging	Het
Scpep1	A	T	11: 88,947,205	F85L	probably damaging	Het
Shank1	T	A	7: 44,313,106		probably null	Het
Slc40a1	T	C	1: 45,909,492	K543E	probably benign	Het
Slc9a9	A	G	9: 94,960,446	Y350C	probably damaging	Het
Sun2	G	T	15: 79,734,219	Y246*	probably null	Het
Tas1r2	T	A	4: 139,669,720	I790N	probably damaging	Het
Tmtc2	T	C	10: 105,323,002	T577A	probably benign	Het
Trim24	T	G	6: 37,919,492		probably null	Het
Ttc12	A	G	9: 49,438,418	V693A	probably benign	Het
Ttc30a2	T	C	2: 75,976,408	R587G	probably damaging	Het
Ttc30a2	A	T	2: 75,977,660	Y169*	probably null	Het
Zbtb22	A	C	17: 33,917,964	D361A	probably damaging	Het
Zfp276	T	A	8: 123,256,831	C324*	probably null	Het
Zfp536	A	G	7: 37,568,527	L488P	probably damaging	Het

Other mutations in Pms1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00494:Pms1	APN	1	53206556	splice site	probably benign
IGL00937:Pms1	APN	1	53275251	missense	possibly damaging	0.74
IGL01505:Pms1	APN	1	53206971	missense	probably benign
IGL02109:Pms1	APN	1	53207409	missense	probably damaging	0.96
IGL02245:Pms1	APN	1	53207360	missense	probably damaging	1.00
IGL02273:Pms1	APN	1	53207997	missense	probably damaging	1.00
IGL02339:Pms1	APN	1	53275165	missense	possibly damaging	0.78
R0157:Pms1	UTSW	1	53195037	nonsense	probably null
R0530:Pms1	UTSW	1	53196813	splice site	probably null
R1398:Pms1	UTSW	1	53207276	missense	possibly damaging	0.88
R1817:Pms1	UTSW	1	53206969	missense	probably benign	0.02
R1831:Pms1	UTSW	1	53207211	missense	probably benign	0.00
R1838:Pms1	UTSW	1	53192098	critical splice donor site	probably null
R1867:Pms1	UTSW	1	53189387	missense	probably benign	0.36
R1874:Pms1	UTSW	1	53207233	missense	probably benign	0.16
R1939:Pms1	UTSW	1	53196976	missense	probably damaging	1.00
R1991:Pms1	UTSW	1	53282042	missense	probably damaging	1.00
R1993:Pms1	UTSW	1	53195015	missense	probably benign
R1995:Pms1	UTSW	1	53195015	missense	probably benign
R2049:Pms1	UTSW	1	53281988	missense	probably damaging	0.99
R2058:Pms1	UTSW	1	53275168	missense	probably benign	0.00
R2140:Pms1	UTSW	1	53281988	missense	probably damaging	0.99
R4078:Pms1	UTSW	1	53267789	splice site	probably null
R4608:Pms1	UTSW	1	53194938	missense	possibly damaging	0.80
R4668:Pms1	UTSW	1	53189474	nonsense	probably null
R5164:Pms1	UTSW	1	53207640	missense	probably damaging	0.99
R5200:Pms1	UTSW	1	53206757	missense	probably benign	0.00
R5397:Pms1	UTSW	1	53192120	nonsense	probably null
R5745:Pms1	UTSW	1	53207702	nonsense	probably null
R6440:Pms1	UTSW	1	53195021	missense	probably damaging	0.98
R6445:Pms1	UTSW	1	53192194	missense	possibly damaging	0.77
R6802:Pms1	UTSW	1	53206792	missense	probably benign	0.06
R7020:Pms1	UTSW	1	53189382	missense	probably damaging	1.00
R7037:Pms1	UTSW	1	53207611	missense	possibly damaging	0.95
R7199:Pms1	UTSW	1	53256730	missense	probably benign	0.02
R7417:Pms1	UTSW	1	53197072	missense	probably benign	0.00
R7587:Pms1	UTSW	1	53207316	missense	probably benign	0.00
R7716:Pms1	UTSW	1	53207608	missense	probably damaging	1.00
R8178:Pms1	UTSW	1	53207346	missense	probably benign	0.00
R8336:Pms1	UTSW	1	53206826	missense	probably benign
R8399:Pms1	UTSW	1	53267932	critical splice acceptor site	probably null
R8692:Pms1	UTSW	1	53206893	missense	probably benign
R8736:Pms1	UTSW	1	53267894	missense	possibly damaging	0.63
R8738:Pms1	UTSW	1	53282036	missense	possibly damaging	0.67
R8751:Pms1	UTSW	1	53192110	missense	probably benign	0.01
R9102:Pms1	UTSW	1	53267862	missense	probably benign	0.11
R9294:Pms1	UTSW	1	53208057	missense	probably benign
R9648:Pms1	UTSW	1	53275125	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTTGAAGGTTGGACGTGAAAAC -3'
(R):5'- AGTTCTGTTGCCAATGACTTTG -3'

Sequencing Primer
(F):5'- GAACCACATCAGTTTCCAT -3'
(R):5'- GTCTCCATAATGTGCAGCATTG -3'

Posted On

2018-11-28