Incidental Mutation 'R6975:Pms1'
ID542396
Institutional Source Beutler Lab
Gene Symbol Pms1
Ensembl Gene ENSMUSG00000026098
Gene NamePMS1 homolog 1, mismatch repair system component
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6975 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location53189187-53297018 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 53189431 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 886 (I886N)
Ref Sequence ENSEMBL: ENSMUSP00000027267 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027267] [ENSMUST00000072235] [ENSMUST00000190748]
Predicted Effect probably damaging
Transcript: ENSMUST00000027267
AA Change: I886N

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000027267
Gene: ENSMUSG00000026098
AA Change: I886N

DomainStartEndE-ValueType
HATPase_c 16 151 3.84e-1 SMART
DNA_mis_repair 210 338 2.46e-25 SMART
low complexity region 457 474 N/A INTRINSIC
HMG 557 627 1.42e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000072235
SMART Domains Protein: ENSMUSP00000072089
Gene: ENSMUSG00000060715

DomainStartEndE-ValueType
coiled coil region 38 68 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190748
SMART Domains Protein: ENSMUSP00000139938
Gene: ENSMUSG00000060715

DomainStartEndE-ValueType
coiled coil region 38 68 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.9%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the DNA mismatch repair mutL/hexB family. This protein is thought to be involved in the repair of DNA mismatches, and it can form heterodimers with MLH1, a known DNA mismatch repair protein. Mutations in this gene cause hereditary nonpolyposis colorectal cancer type 3 (HNPCC3) either alone or in combination with mutations in other genes involved in the HNPCC phenotype, which is also known as Lynch syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit a modest increase in DNA mismatch repair errors, primarily single base pair substitutions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,294,057 H100L probably benign Het
Apaf1 A T 10: 91,020,734 H870Q probably damaging Het
Aplf T C 6: 87,646,086 D358G probably damaging Het
Atp10a A T 7: 58,773,985 S233C probably damaging Het
BC022687 C T 12: 112,809,597 P70L possibly damaging Het
Ccdc158 A T 5: 92,666,720 Y82* probably null Het
Cubn T C 2: 13,486,789 D149G probably damaging Het
Cyp4f14 T C 17: 32,914,634 T83A probably benign Het
Endog A G 2: 30,171,636 probably benign Het
Extl3 T C 14: 65,066,797 E721G probably benign Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gcn1l1 A G 5: 115,613,459 H2033R probably damaging Het
Gm12830 T C 4: 114,845,049 M136T Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gm6871 T C 7: 41,546,778 silent Het
Hoxc4 T C 15: 103,035,672 S159P probably damaging Het
Igf2bp2 T A 16: 22,061,861 Q494L probably null Het
Igfn1 T A 1: 135,968,445 N1461I probably damaging Het
Il23r C A 6: 67,423,368 K659N probably damaging Het
Map3k11 A G 19: 5,690,727 S161G possibly damaging Het
Naip6 T A 13: 100,316,265 Q96L probably damaging Het
Nup133 T C 8: 123,915,318 E802G probably damaging Het
Nutm1 G A 2: 112,256,218 S56F probably damaging Het
Olfr248 T A 1: 174,391,677 S203T probably benign Het
Olfr645 T C 7: 104,084,795 N95S probably benign Het
Otop2 A T 11: 115,329,326 S331C possibly damaging Het
Pkd1l3 A G 8: 109,660,907 R1818G possibly damaging Het
Pnpla6 A G 8: 3,538,068 Y1107C probably damaging Het
Ppp3ca A G 3: 136,905,301 T362A probably damaging Het
Rarb A G 14: 16,574,942 S25P possibly damaging Het
Rnf121 A T 7: 102,024,011 probably null Het
Sae1 T C 7: 16,336,787 Y266C probably damaging Het
Scpep1 A T 11: 88,947,205 F85L probably damaging Het
Shank1 T A 7: 44,313,106 probably null Het
Slc40a1 T C 1: 45,909,492 K543E probably benign Het
Slc9a9 A G 9: 94,960,446 Y350C probably damaging Het
Sun2 G T 15: 79,734,219 Y246* probably null Het
Tas1r2 T A 4: 139,669,720 I790N probably damaging Het
Tmtc2 T C 10: 105,323,002 T577A probably benign Het
Trim24 T G 6: 37,919,492 probably null Het
Ttc12 A G 9: 49,438,418 V693A probably benign Het
Ttc30a2 T C 2: 75,976,408 R587G probably damaging Het
Ttc30a2 A T 2: 75,977,660 Y169* probably null Het
Zbtb22 A C 17: 33,917,964 D361A probably damaging Het
Zfp276 T A 8: 123,256,831 C324* probably null Het
Zfp536 A G 7: 37,568,527 L488P probably damaging Het
Other mutations in Pms1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Pms1 APN 1 53206556 splice site probably benign
IGL00937:Pms1 APN 1 53275251 missense possibly damaging 0.74
IGL01505:Pms1 APN 1 53206971 missense probably benign
IGL02109:Pms1 APN 1 53207409 missense probably damaging 0.96
IGL02245:Pms1 APN 1 53207360 missense probably damaging 1.00
IGL02273:Pms1 APN 1 53207997 missense probably damaging 1.00
IGL02339:Pms1 APN 1 53275165 missense possibly damaging 0.78
R0157:Pms1 UTSW 1 53195037 nonsense probably null
R0530:Pms1 UTSW 1 53196813 unclassified probably null
R1398:Pms1 UTSW 1 53207276 missense possibly damaging 0.88
R1817:Pms1 UTSW 1 53206969 missense probably benign 0.02
R1831:Pms1 UTSW 1 53207211 missense probably benign 0.00
R1838:Pms1 UTSW 1 53192098 critical splice donor site probably null
R1867:Pms1 UTSW 1 53189387 missense probably benign 0.36
R1874:Pms1 UTSW 1 53207233 missense probably benign 0.16
R1939:Pms1 UTSW 1 53196976 missense probably damaging 1.00
R1991:Pms1 UTSW 1 53282042 missense probably damaging 1.00
R1993:Pms1 UTSW 1 53195015 missense probably benign
R1995:Pms1 UTSW 1 53195015 missense probably benign
R2049:Pms1 UTSW 1 53281988 missense probably damaging 0.99
R2058:Pms1 UTSW 1 53275168 missense probably benign 0.00
R2140:Pms1 UTSW 1 53281988 missense probably damaging 0.99
R4078:Pms1 UTSW 1 53267789 unclassified probably null
R4608:Pms1 UTSW 1 53194938 missense possibly damaging 0.80
R4668:Pms1 UTSW 1 53189474 nonsense probably null
R5164:Pms1 UTSW 1 53207640 missense probably damaging 0.99
R5200:Pms1 UTSW 1 53206757 missense probably benign 0.00
R5397:Pms1 UTSW 1 53192120 nonsense probably null
R5745:Pms1 UTSW 1 53207702 nonsense probably null
R6440:Pms1 UTSW 1 53195021 missense probably damaging 0.98
R6445:Pms1 UTSW 1 53192194 missense possibly damaging 0.77
R6802:Pms1 UTSW 1 53206792 missense probably benign 0.06
R7020:Pms1 UTSW 1 53189382 missense probably damaging 1.00
R7037:Pms1 UTSW 1 53207611 missense possibly damaging 0.95
R7199:Pms1 UTSW 1 53256730 missense probably benign 0.02
R7417:Pms1 UTSW 1 53197072 missense probably benign 0.00
R7587:Pms1 UTSW 1 53207316 missense probably benign 0.00
R7716:Pms1 UTSW 1 53207608 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGAAGGTTGGACGTGAAAAC -3'
(R):5'- AGTTCTGTTGCCAATGACTTTG -3'

Sequencing Primer
(F):5'- GAACCACATCAGTTTCCAT -3'
(R):5'- GTCTCCATAATGTGCAGCATTG -3'
Posted On2018-11-28