Incidental Mutation 'R6975:Ccdc158'
ID542408
Institutional Source Beutler Lab
Gene Symbol Ccdc158
Ensembl Gene ENSMUSG00000050050
Gene Namecoiled-coil domain containing 158
Synonyms4932413O14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.180) question?
Stock #R6975 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location92607954-92675271 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 92666720 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 82 (Y82*)
Ref Sequence ENSEMBL: ENSMUSP00000117894 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060930] [ENSMUST00000150359] [ENSMUST00000151180]
Predicted Effect probably null
Transcript: ENSMUST00000060930
AA Change: Y82*
SMART Domains Protein: ENSMUSP00000063050
Gene: ENSMUSG00000050050
AA Change: Y82*

DomainStartEndE-ValueType
Pfam:CCDC158 1 1109 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000150359
AA Change: Y82*
SMART Domains Protein: ENSMUSP00000123259
Gene: ENSMUSG00000050050
AA Change: Y82*

DomainStartEndE-ValueType
Pfam:CCDC158 1 346 1.5e-220 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000151180
AA Change: Y82*
SMART Domains Protein: ENSMUSP00000117894
Gene: ENSMUSG00000050050
AA Change: Y82*

DomainStartEndE-ValueType
coiled coil region 71 105 N/A INTRINSIC
coiled coil region 127 166 N/A INTRINSIC
coiled coil region 244 343 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.9%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,294,057 H100L probably benign Het
Apaf1 A T 10: 91,020,734 H870Q probably damaging Het
Aplf T C 6: 87,646,086 D358G probably damaging Het
Atp10a A T 7: 58,773,985 S233C probably damaging Het
BC022687 C T 12: 112,809,597 P70L possibly damaging Het
Cubn T C 2: 13,486,789 D149G probably damaging Het
Cyp4f14 T C 17: 32,914,634 T83A probably benign Het
Endog A G 2: 30,171,636 probably benign Het
Extl3 T C 14: 65,066,797 E721G probably benign Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gcn1l1 A G 5: 115,613,459 H2033R probably damaging Het
Gm12830 T C 4: 114,845,049 M136T Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gm6871 T C 7: 41,546,778 silent Het
Hoxc4 T C 15: 103,035,672 S159P probably damaging Het
Igf2bp2 T A 16: 22,061,861 Q494L probably null Het
Igfn1 T A 1: 135,968,445 N1461I probably damaging Het
Il23r C A 6: 67,423,368 K659N probably damaging Het
Map3k11 A G 19: 5,690,727 S161G possibly damaging Het
Naip6 T A 13: 100,316,265 Q96L probably damaging Het
Nup133 T C 8: 123,915,318 E802G probably damaging Het
Nutm1 G A 2: 112,256,218 S56F probably damaging Het
Olfr248 T A 1: 174,391,677 S203T probably benign Het
Olfr645 T C 7: 104,084,795 N95S probably benign Het
Otop2 A T 11: 115,329,326 S331C possibly damaging Het
Pkd1l3 A G 8: 109,660,907 R1818G possibly damaging Het
Pms1 A T 1: 53,189,431 I886N probably damaging Het
Pnpla6 A G 8: 3,538,068 Y1107C probably damaging Het
Ppp3ca A G 3: 136,905,301 T362A probably damaging Het
Rarb A G 14: 16,574,942 S25P possibly damaging Het
Rnf121 A T 7: 102,024,011 probably null Het
Sae1 T C 7: 16,336,787 Y266C probably damaging Het
Scpep1 A T 11: 88,947,205 F85L probably damaging Het
Shank1 T A 7: 44,313,106 probably null Het
Slc40a1 T C 1: 45,909,492 K543E probably benign Het
Slc9a9 A G 9: 94,960,446 Y350C probably damaging Het
Sun2 G T 15: 79,734,219 Y246* probably null Het
Tas1r2 T A 4: 139,669,720 I790N probably damaging Het
Tmtc2 T C 10: 105,323,002 T577A probably benign Het
Trim24 T G 6: 37,919,492 probably null Het
Ttc12 A G 9: 49,438,418 V693A probably benign Het
Ttc30a2 T C 2: 75,976,408 R587G probably damaging Het
Ttc30a2 A T 2: 75,977,660 Y169* probably null Het
Zbtb22 A C 17: 33,917,964 D361A probably damaging Het
Zfp276 T A 8: 123,256,831 C324* probably null Het
Zfp536 A G 7: 37,568,527 L488P probably damaging Het
Other mutations in Ccdc158
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Ccdc158 APN 5 92657881 missense probably benign 0.01
IGL00926:Ccdc158 APN 5 92650767 missense probably damaging 0.98
IGL01533:Ccdc158 APN 5 92609956 splice site probably null
IGL01551:Ccdc158 APN 5 92666761 missense probably damaging 0.96
IGL01591:Ccdc158 APN 5 92662041 missense probably benign 0.28
IGL01722:Ccdc158 APN 5 92662739 missense possibly damaging 0.93
IGL02250:Ccdc158 APN 5 92608478 missense probably damaging 1.00
IGL02457:Ccdc158 APN 5 92650048 missense probably damaging 1.00
IGL02570:Ccdc158 APN 5 92649026 missense possibly damaging 0.81
IGL02951:Ccdc158 APN 5 92650006 missense probably damaging 1.00
IGL03275:Ccdc158 APN 5 92629632 missense probably benign 0.00
R0238:Ccdc158 UTSW 5 92662118 missense probably benign 0.31
R0238:Ccdc158 UTSW 5 92662118 missense probably benign 0.31
R0747:Ccdc158 UTSW 5 92633297 missense probably benign 0.00
R1219:Ccdc158 UTSW 5 92654181 splice site probably benign
R1480:Ccdc158 UTSW 5 92649044 missense probably damaging 1.00
R1926:Ccdc158 UTSW 5 92650788 missense probably benign 0.41
R2172:Ccdc158 UTSW 5 92632508 missense probably damaging 1.00
R2245:Ccdc158 UTSW 5 92609952 unclassified probably benign
R3004:Ccdc158 UTSW 5 92649070 missense probably damaging 1.00
R3147:Ccdc158 UTSW 5 92657963 missense probably damaging 1.00
R3693:Ccdc158 UTSW 5 92610045 missense probably damaging 1.00
R3694:Ccdc158 UTSW 5 92610045 missense probably damaging 1.00
R3735:Ccdc158 UTSW 5 92632424 missense possibly damaging 0.60
R3736:Ccdc158 UTSW 5 92632424 missense possibly damaging 0.60
R3912:Ccdc158 UTSW 5 92648935 missense possibly damaging 0.90
R4026:Ccdc158 UTSW 5 92643807 missense probably benign 0.07
R4080:Ccdc158 UTSW 5 92623396 missense probably benign 0.00
R4463:Ccdc158 UTSW 5 92634300 missense probably null 0.99
R4483:Ccdc158 UTSW 5 92633328 missense probably benign 0.01
R4859:Ccdc158 UTSW 5 92633403 missense probably damaging 0.99
R5016:Ccdc158 UTSW 5 92657892 missense probably benign 0.01
R5050:Ccdc158 UTSW 5 92666879 missense probably benign 0.01
R5372:Ccdc158 UTSW 5 92632560 missense possibly damaging 0.55
R5427:Ccdc158 UTSW 5 92648962 missense probably damaging 1.00
R5847:Ccdc158 UTSW 5 92627480 missense probably benign 0.00
R5966:Ccdc158 UTSW 5 92650049 missense probably damaging 1.00
R6106:Ccdc158 UTSW 5 92627466 missense probably benign
R6185:Ccdc158 UTSW 5 92666854 missense possibly damaging 0.73
R6562:Ccdc158 UTSW 5 92662722 missense probably damaging 0.99
R6743:Ccdc158 UTSW 5 92662146 missense probably benign 0.08
R6815:Ccdc158 UTSW 5 92612486 missense probably damaging 0.99
R6914:Ccdc158 UTSW 5 92662070 missense probably benign 0.00
R7252:Ccdc158 UTSW 5 92650788 missense probably benign 0.41
R7477:Ccdc158 UTSW 5 92650696 missense probably damaging 0.96
R7782:Ccdc158 UTSW 5 92645514 missense probably benign 0.00
R8014:Ccdc158 UTSW 5 92649030 missense probably damaging 1.00
R8018:Ccdc158 UTSW 5 92623401 missense possibly damaging 0.64
X0025:Ccdc158 UTSW 5 92662012 missense probably benign
Z1176:Ccdc158 UTSW 5 92608491 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTTCTATCACTGTTTGCAAAGAG -3'
(R):5'- TAGTGTTTGCCTCACAGTTGTC -3'

Sequencing Primer
(F):5'- GCAGGCCTGAACCAATTATTAATAGC -3'
(R):5'- CTAATATTTAGGTTCTTCAAGCCCG -3'
Posted On2018-11-28