Incidental Mutation 'R6975:Sae1'
ID 542414
Institutional Source Beutler Lab
Gene Symbol Sae1
Ensembl Gene ENSMUSG00000052833
Gene Name SUMO1 activating enzyme subunit 1
Synonyms 2400010M20Rik, SUMO-1 activating enzyme subunit 1, HSPC140, AOS1, Uble1a, 2610044L12Rik, D7Ertd177e
MMRRC Submission 045085-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.964) question?
Stock # R6975 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 16054159-16121731 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 16070712 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 266 (Y266C)
Ref Sequence ENSEMBL: ENSMUSP00000147409 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094815] [ENSMUST00000210999] [ENSMUST00000211741]
AlphaFold Q9R1T2
Predicted Effect probably damaging
Transcript: ENSMUST00000094815
AA Change: Y266C

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000092409
Gene: ENSMUSG00000052833
AA Change: Y266C

DomainStartEndE-ValueType
low complexity region 3 21 N/A INTRINSIC
Pfam:ThiF 23 344 4.3e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000210999
AA Change: Y266C

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000211741
AA Change: Y266C

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.9%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Posttranslational modification of proteins by the addition of the small protein SUMO (see SUMO1; MIM 601912), or sumoylation, regulates protein structure and intracellular localization. SAE1 and UBA2 (MIM 613295) form a heterodimer that functions as a SUMO-activating enzyme for the sumoylation of proteins (Okuma et al., 1999 [PubMed 9920803]).[supplied by OMIM, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,056,687 (GRCm39) H100L probably benign Het
Apaf1 A T 10: 90,856,596 (GRCm39) H870Q probably damaging Het
Aplf T C 6: 87,623,068 (GRCm39) D358G probably damaging Het
Atp10a A T 7: 58,423,733 (GRCm39) S233C probably damaging Het
Ccdc158 A T 5: 92,814,579 (GRCm39) Y82* probably null Het
Clba1 C T 12: 112,773,217 (GRCm39) P70L possibly damaging Het
Cubn T C 2: 13,491,600 (GRCm39) D149G probably damaging Het
Cyp4f14 T C 17: 33,133,608 (GRCm39) T83A probably benign Het
Endog A G 2: 30,061,648 (GRCm39) probably benign Het
Extl3 T C 14: 65,304,246 (GRCm39) E721G probably benign Het
Gatad1 T C 5: 3,693,540 (GRCm39) R210G probably benign Het
Gcn1 A G 5: 115,751,518 (GRCm39) H2033R probably damaging Het
Gm12830 T C 4: 114,702,246 (GRCm39) M136T Het
Gm6871 T C 7: 41,196,202 (GRCm39) silent Het
Hoxc4 T C 15: 102,944,098 (GRCm39) S159P probably damaging Het
Ift70a2 T C 2: 75,806,752 (GRCm39) R587G probably damaging Het
Ift70a2 A T 2: 75,808,004 (GRCm39) Y169* probably null Het
Igf2bp2 T A 16: 21,880,611 (GRCm39) Q494L probably null Het
Igfn1 T A 1: 135,896,183 (GRCm39) N1461I probably damaging Het
Il23r C A 6: 67,400,352 (GRCm39) K659N probably damaging Het
Map3k11 A G 19: 5,740,755 (GRCm39) S161G possibly damaging Het
Naip6 T A 13: 100,452,773 (GRCm39) Q96L probably damaging Het
Nup133 T C 8: 124,642,057 (GRCm39) E802G probably damaging Het
Nutm1 G A 2: 112,086,563 (GRCm39) S56F probably damaging Het
Or10x4 T A 1: 174,219,243 (GRCm39) S203T probably benign Het
Or51a24 T C 7: 103,734,002 (GRCm39) N95S probably benign Het
Otop2 A T 11: 115,220,152 (GRCm39) S331C possibly damaging Het
Pira1 C G 7: 3,740,319 (GRCm39) A301P probably damaging Het
Pkd1l3 A G 8: 110,387,539 (GRCm39) R1818G possibly damaging Het
Pms1 A T 1: 53,228,590 (GRCm39) I886N probably damaging Het
Pnpla6 A G 8: 3,588,068 (GRCm39) Y1107C probably damaging Het
Ppp3ca A G 3: 136,611,062 (GRCm39) T362A probably damaging Het
Rarb A G 14: 16,574,942 (GRCm38) S25P possibly damaging Het
Rnf121 A T 7: 101,673,218 (GRCm39) probably null Het
Scpep1 A T 11: 88,838,031 (GRCm39) F85L probably damaging Het
Shank1 T A 7: 43,962,530 (GRCm39) probably null Het
Slc40a1 T C 1: 45,948,652 (GRCm39) K543E probably benign Het
Slc9a9 A G 9: 94,842,499 (GRCm39) Y350C probably damaging Het
Sun2 G T 15: 79,618,420 (GRCm39) Y246* probably null Het
Tas1r2 T A 4: 139,397,031 (GRCm39) I790N probably damaging Het
Tmtc2 T C 10: 105,158,863 (GRCm39) T577A probably benign Het
Trim24 T G 6: 37,896,427 (GRCm39) probably null Het
Ttc12 A G 9: 49,349,718 (GRCm39) V693A probably benign Het
Zbtb22 A C 17: 34,136,938 (GRCm39) D361A probably damaging Het
Zfp276 T A 8: 123,983,570 (GRCm39) C324* probably null Het
Zfp536 A G 7: 37,267,952 (GRCm39) L488P probably damaging Het
Other mutations in Sae1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02206:Sae1 APN 7 16,064,581 (GRCm39) missense possibly damaging 0.94
IGL02672:Sae1 APN 7 16,104,273 (GRCm39) missense probably damaging 1.00
IGL02881:Sae1 APN 7 16,093,043 (GRCm39) missense probably damaging 1.00
R0255:Sae1 UTSW 7 16,104,247 (GRCm39) nonsense probably null
R0667:Sae1 UTSW 7 16,102,457 (GRCm39) missense probably damaging 1.00
R1374:Sae1 UTSW 7 16,112,333 (GRCm39) missense probably damaging 0.97
R1585:Sae1 UTSW 7 16,064,537 (GRCm39) critical splice donor site probably null
R1960:Sae1 UTSW 7 16,102,490 (GRCm39) missense possibly damaging 0.90
R2278:Sae1 UTSW 7 16,104,291 (GRCm39) missense probably damaging 1.00
R5513:Sae1 UTSW 7 16,100,781 (GRCm39) missense probably benign 0.00
R5677:Sae1 UTSW 7 16,104,387 (GRCm39) critical splice acceptor site probably null
R6694:Sae1 UTSW 7 16,102,461 (GRCm39) missense probably damaging 1.00
R7307:Sae1 UTSW 7 16,102,469 (GRCm39) nonsense probably null
R7914:Sae1 UTSW 7 16,121,648 (GRCm39) missense unknown
R8437:Sae1 UTSW 7 16,104,279 (GRCm39) missense probably damaging 1.00
R9076:Sae1 UTSW 7 16,070,668 (GRCm39) missense probably benign
Z1177:Sae1 UTSW 7 16,061,796 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGAGGTGGTTTAAGCAGC -3'
(R):5'- AGTGTATTGCCTTTCACCTGG -3'

Sequencing Primer
(F):5'- GCAAATGTGGCACAGGAGTCC -3'
(R):5'- CACCTGGCCTACATTTTGATTAATG -3'
Posted On 2018-11-28