Incidental Mutation 'R6975:Sae1'
ID 542414
Institutional Source Beutler Lab
Gene Symbol Sae1
Ensembl Gene ENSMUSG00000052833
Gene Name SUMO1 activating enzyme subunit 1
Synonyms HSPC140, D7Ertd177e, Uble1a, 2610044L12Rik, AOS1, 2400010M20Rik, SUMO-1 activating enzyme subunit 1
MMRRC Submission 045085-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.966) question?
Stock # R6975 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 16320234-16387806 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 16336787 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 266 (Y266C)
Ref Sequence ENSEMBL: ENSMUSP00000147409 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094815] [ENSMUST00000210999] [ENSMUST00000211741]
AlphaFold Q9R1T2
Predicted Effect probably damaging
Transcript: ENSMUST00000094815
AA Change: Y266C

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000092409
Gene: ENSMUSG00000052833
AA Change: Y266C

DomainStartEndE-ValueType
low complexity region 3 21 N/A INTRINSIC
Pfam:ThiF 23 344 4.3e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000210999
AA Change: Y266C

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000211741
AA Change: Y266C

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.9%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Posttranslational modification of proteins by the addition of the small protein SUMO (see SUMO1; MIM 601912), or sumoylation, regulates protein structure and intracellular localization. SAE1 and UBA2 (MIM 613295) form a heterodimer that functions as a SUMO-activating enzyme for the sumoylation of proteins (Okuma et al., 1999 [PubMed 9920803]).[supplied by OMIM, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,294,057 H100L probably benign Het
Apaf1 A T 10: 91,020,734 H870Q probably damaging Het
Aplf T C 6: 87,646,086 D358G probably damaging Het
Atp10a A T 7: 58,773,985 S233C probably damaging Het
BC022687 C T 12: 112,809,597 P70L possibly damaging Het
Ccdc158 A T 5: 92,666,720 Y82* probably null Het
Cubn T C 2: 13,486,789 D149G probably damaging Het
Cyp4f14 T C 17: 32,914,634 T83A probably benign Het
Endog A G 2: 30,171,636 probably benign Het
Extl3 T C 14: 65,066,797 E721G probably benign Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gcn1l1 A G 5: 115,613,459 H2033R probably damaging Het
Gm12830 T C 4: 114,845,049 M136T Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gm6871 T C 7: 41,546,778 silent Het
Hoxc4 T C 15: 103,035,672 S159P probably damaging Het
Igf2bp2 T A 16: 22,061,861 Q494L probably null Het
Igfn1 T A 1: 135,968,445 N1461I probably damaging Het
Il23r C A 6: 67,423,368 K659N probably damaging Het
Map3k11 A G 19: 5,690,727 S161G possibly damaging Het
Naip6 T A 13: 100,316,265 Q96L probably damaging Het
Nup133 T C 8: 123,915,318 E802G probably damaging Het
Nutm1 G A 2: 112,256,218 S56F probably damaging Het
Olfr248 T A 1: 174,391,677 S203T probably benign Het
Olfr645 T C 7: 104,084,795 N95S probably benign Het
Otop2 A T 11: 115,329,326 S331C possibly damaging Het
Pkd1l3 A G 8: 109,660,907 R1818G possibly damaging Het
Pms1 A T 1: 53,189,431 I886N probably damaging Het
Pnpla6 A G 8: 3,538,068 Y1107C probably damaging Het
Ppp3ca A G 3: 136,905,301 T362A probably damaging Het
Rarb A G 14: 16,574,942 S25P possibly damaging Het
Rnf121 A T 7: 102,024,011 probably null Het
Scpep1 A T 11: 88,947,205 F85L probably damaging Het
Shank1 T A 7: 44,313,106 probably null Het
Slc40a1 T C 1: 45,909,492 K543E probably benign Het
Slc9a9 A G 9: 94,960,446 Y350C probably damaging Het
Sun2 G T 15: 79,734,219 Y246* probably null Het
Tas1r2 T A 4: 139,669,720 I790N probably damaging Het
Tmtc2 T C 10: 105,323,002 T577A probably benign Het
Trim24 T G 6: 37,919,492 probably null Het
Ttc12 A G 9: 49,438,418 V693A probably benign Het
Ttc30a2 T C 2: 75,976,408 R587G probably damaging Het
Ttc30a2 A T 2: 75,977,660 Y169* probably null Het
Zbtb22 A C 17: 33,917,964 D361A probably damaging Het
Zfp276 T A 8: 123,256,831 C324* probably null Het
Zfp536 A G 7: 37,568,527 L488P probably damaging Het
Other mutations in Sae1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02206:Sae1 APN 7 16330656 missense possibly damaging 0.94
IGL02672:Sae1 APN 7 16370348 missense probably damaging 1.00
IGL02881:Sae1 APN 7 16359118 missense probably damaging 1.00
R0255:Sae1 UTSW 7 16370322 nonsense probably null
R0667:Sae1 UTSW 7 16368532 missense probably damaging 1.00
R1374:Sae1 UTSW 7 16378408 missense probably damaging 0.97
R1585:Sae1 UTSW 7 16330612 critical splice donor site probably null
R1960:Sae1 UTSW 7 16368565 missense possibly damaging 0.90
R2278:Sae1 UTSW 7 16370366 missense probably damaging 1.00
R5513:Sae1 UTSW 7 16366856 missense probably benign 0.00
R5677:Sae1 UTSW 7 16370462 critical splice acceptor site probably null
R6694:Sae1 UTSW 7 16368536 missense probably damaging 1.00
R7307:Sae1 UTSW 7 16368544 nonsense probably null
R7914:Sae1 UTSW 7 16387723 missense unknown
R8437:Sae1 UTSW 7 16370354 missense probably damaging 1.00
R9076:Sae1 UTSW 7 16336743 missense probably benign
Z1177:Sae1 UTSW 7 16327871 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGAGGTGGTTTAAGCAGC -3'
(R):5'- AGTGTATTGCCTTTCACCTGG -3'

Sequencing Primer
(F):5'- GCAAATGTGGCACAGGAGTCC -3'
(R):5'- CACCTGGCCTACATTTTGATTAATG -3'
Posted On 2018-11-28