Mutagenetix > Incidental Mutations

Incidental Mutation 'R6975:Atp10a'

542417

Institutional Source

Beutler Lab

Gene Symbol

Atp10a

Ensembl Gene

ENSMUSG00000025324

Gene Name

ATPase, class V, type 10A

Synonyms

Atp10c, pfatp

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.094) question?

Stock #

R6975 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

58656166-58829420 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 58773985 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Cysteine at position 233 (S233C)

Ref Sequence

ENSEMBL: ENSMUSP00000129811 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168747]

Predicted Effect

probably damaging
Transcript: ENSMUST00000168747
AA Change: S233C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000129811
Gene: ENSMUSG00000025324
AA Change: S233C

Domain	Start	End	E-Value	Type
low complexity region	15	32	N/A	INTRINSIC
Pfam:PhoLip_ATPase_N	55	114	5.2e-23	PFAM
Pfam:E1-E2_ATPase	120	393	6.6e-10	PFAM
low complexity region	633	643	N/A	INTRINSIC
Pfam:Cation_ATPase	685	791	1.5e-7	PFAM
Pfam:HAD	697	1054	2.1e-12	PFAM
Pfam:PhoLip_ATPase_C	1071	1316	1.1e-76	PFAM
low complexity region	1458	1477	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 96.9%

Validation Efficiency

100% (46/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to another. This gene is maternally expressed. It maps within the most common interval of deletion responsible for Angelman syndrome, also known as 'happy puppet syndrome'. [provided by RefSeq, Jul 2008]
PHENOTYPE: Disruption of this gene at the distal end of the p^23DFiOD deletion may be responsible for the obesity phenotypes associated with that deletion. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010315B03Rik	T	A	9: 124,294,057	H100L	probably benign	Het
Apaf1	A	T	10: 91,020,734	H870Q	probably damaging	Het
Aplf	T	C	6: 87,646,086	D358G	probably damaging	Het
BC022687	C	T	12: 112,809,597	P70L	possibly damaging	Het
Ccdc158	A	T	5: 92,666,720	Y82*	probably null	Het
Cubn	T	C	2: 13,486,789	D149G	probably damaging	Het
Cyp4f14	T	C	17: 32,914,634	T83A	probably benign	Het
Endog	A	G	2: 30,171,636		probably benign	Het
Extl3	T	C	14: 65,066,797	E721G	probably benign	Het
Gatad1	T	C	5: 3,643,540	R210G	probably benign	Het
Gcn1l1	A	G	5: 115,613,459	H2033R	probably damaging	Het
Gm12830	T	C	4: 114,845,049	M136T		Het
Gm15922	C	G	7: 3,737,320	A301P	probably damaging	Het
Gm6871	T	C	7: 41,546,778		silent	Het
Hoxc4	T	C	15: 103,035,672	S159P	probably damaging	Het
Igf2bp2	T	A	16: 22,061,861	Q494L	probably null	Het
Igfn1	T	A	1: 135,968,445	N1461I	probably damaging	Het
Il23r	C	A	6: 67,423,368	K659N	probably damaging	Het
Map3k11	A	G	19: 5,690,727	S161G	possibly damaging	Het
Naip6	T	A	13: 100,316,265	Q96L	probably damaging	Het
Nup133	T	C	8: 123,915,318	E802G	probably damaging	Het
Nutm1	G	A	2: 112,256,218	S56F	probably damaging	Het
Olfr248	T	A	1: 174,391,677	S203T	probably benign	Het
Olfr645	T	C	7: 104,084,795	N95S	probably benign	Het
Otop2	A	T	11: 115,329,326	S331C	possibly damaging	Het
Pkd1l3	A	G	8: 109,660,907	R1818G	possibly damaging	Het
Pms1	A	T	1: 53,189,431	I886N	probably damaging	Het
Pnpla6	A	G	8: 3,538,068	Y1107C	probably damaging	Het
Ppp3ca	A	G	3: 136,905,301	T362A	probably damaging	Het
Rarb	A	G	14: 16,574,942	S25P	possibly damaging	Het
Rnf121	A	T	7: 102,024,011		probably null	Het
Sae1	T	C	7: 16,336,787	Y266C	probably damaging	Het
Scpep1	A	T	11: 88,947,205	F85L	probably damaging	Het
Shank1	T	A	7: 44,313,106		probably null	Het
Slc40a1	T	C	1: 45,909,492	K543E	probably benign	Het
Slc9a9	A	G	9: 94,960,446	Y350C	probably damaging	Het
Sun2	G	T	15: 79,734,219	Y246*	probably null	Het
Tas1r2	T	A	4: 139,669,720	I790N	probably damaging	Het
Tmtc2	T	C	10: 105,323,002	T577A	probably benign	Het
Trim24	T	G	6: 37,919,492		probably null	Het
Ttc12	A	G	9: 49,438,418	V693A	probably benign	Het
Ttc30a2	T	C	2: 75,976,408	R587G	probably damaging	Het
Ttc30a2	A	T	2: 75,977,660	Y169*	probably null	Het
Zbtb22	A	C	17: 33,917,964	D361A	probably damaging	Het
Zfp276	T	A	8: 123,256,831	C324*	probably null	Het
Zfp536	A	G	7: 37,568,527	L488P	probably damaging	Het

Other mutations in Atp10a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00649:Atp10a	APN	7	58794482	missense	probably benign	0.06
IGL00973:Atp10a	APN	7	58807470	missense	probably damaging	1.00
IGL00984:Atp10a	APN	7	58658741	missense	probably damaging	1.00
IGL01086:Atp10a	APN	7	58824318	missense	probably damaging	0.96
IGL01296:Atp10a	APN	7	58813625	missense	probably benign	0.02
IGL01731:Atp10a	APN	7	58797562	missense	probably benign	0.16
IGL02081:Atp10a	APN	7	58827856	missense	possibly damaging	0.62
IGL02095:Atp10a	APN	7	58807393	missense	probably damaging	1.00
IGL02549:Atp10a	APN	7	58819733	missense	probably benign	0.00
IGL02558:Atp10a	APN	7	58819642	missense	probably damaging	0.98
IGL02659:Atp10a	APN	7	58813631	missense	probably benign
IGL02986:Atp10a	APN	7	58828721	missense	probably benign
IGL03218:Atp10a	APN	7	58788448	critical splice donor site	probably null
PIT4260001:Atp10a	UTSW	7	58791118	nonsense	probably null
PIT4445001:Atp10a	UTSW	7	58803467	missense	probably damaging	0.98
PIT4810001:Atp10a	UTSW	7	58813848	missense	probably damaging	0.99
R0091:Atp10a	UTSW	7	58774046	splice site	probably benign
R0349:Atp10a	UTSW	7	58803467	missense	probably damaging	0.98
R0426:Atp10a	UTSW	7	58784734	missense	probably benign	0.00
R0609:Atp10a	UTSW	7	58819740	splice site	probably null
R0722:Atp10a	UTSW	7	58816183	missense	possibly damaging	0.75
R0741:Atp10a	UTSW	7	58828589	missense	possibly damaging	0.90
R1172:Atp10a	UTSW	7	58803766	missense	probably benign	0.05
R1342:Atp10a	UTSW	7	58816146	splice site	probably benign
R1648:Atp10a	UTSW	7	58784827	missense	probably damaging	1.00
R1715:Atp10a	UTSW	7	58786505	missense	probably damaging	0.98
R1737:Atp10a	UTSW	7	58827238	splice site	probably benign
R1799:Atp10a	UTSW	7	58824434	missense	probably damaging	1.00
R1909:Atp10a	UTSW	7	58828712	missense	probably benign	0.12
R1918:Atp10a	UTSW	7	58827935	missense	possibly damaging	0.82
R2031:Atp10a	UTSW	7	58827930	nonsense	probably null
R2080:Atp10a	UTSW	7	58824327	missense	probably damaging	0.97
R2424:Atp10a	UTSW	7	58794555	missense	probably benign	0.16
R2696:Atp10a	UTSW	7	58813618	missense	probably benign	0.00
R3932:Atp10a	UTSW	7	58827104	missense	possibly damaging	0.69
R4198:Atp10a	UTSW	7	58813686	missense	probably damaging	1.00
R4453:Atp10a	UTSW	7	58658500	small deletion	probably benign
R4632:Atp10a	UTSW	7	58807438	missense	possibly damaging	0.48
R4661:Atp10a	UTSW	7	58658500	small deletion	probably benign
R4782:Atp10a	UTSW	7	58791095	missense	probably benign
R4888:Atp10a	UTSW	7	58785307	missense	probably damaging	1.00
R4935:Atp10a	UTSW	7	58813764	missense	probably damaging	1.00
R5051:Atp10a	UTSW	7	58740246	frame shift	probably null
R5213:Atp10a	UTSW	7	58773983	missense	probably damaging	0.99
R5617:Atp10a	UTSW	7	58803675	missense	probably benign	0.06
R5834:Atp10a	UTSW	7	58658618	missense	probably benign	0.01
R5885:Atp10a	UTSW	7	58813800	missense	possibly damaging	0.92
R6013:Atp10a	UTSW	7	58797790	missense	probably benign	0.05
R6136:Atp10a	UTSW	7	58828340	missense	probably benign
R6269:Atp10a	UTSW	7	58803739	missense	possibly damaging	0.51
R6380:Atp10a	UTSW	7	58819684	nonsense	probably null
R6743:Atp10a	UTSW	7	58797814	missense	possibly damaging	0.89
R6875:Atp10a	UTSW	7	58797352	missense	probably benign	0.01
R7082:Atp10a	UTSW	7	58658819	missense	probably damaging	1.00
R7203:Atp10a	UTSW	7	58786473	missense	probably benign
R7224:Atp10a	UTSW	7	58797471	missense	probably benign	0.00
R7287:Atp10a	UTSW	7	58827269	missense	probably damaging	1.00
R7437:Atp10a	UTSW	7	58658540	missense	unknown
R7474:Atp10a	UTSW	7	58658527	missense	unknown
R7530:Atp10a	UTSW	7	58773976	missense	probably benign	0.02
R7561:Atp10a	UTSW	7	58827133	missense	probably damaging	0.98
R7743:Atp10a	UTSW	7	58803709	missense	probably damaging	1.00
R7767:Atp10a	UTSW	7	58658849	missense	probably damaging	1.00
R7861:Atp10a	UTSW	7	58788359	missense	probably damaging	1.00
R7903:Atp10a	UTSW	7	58658822	missense	probably damaging	1.00
R8015:Atp10a	UTSW	7	58803497	missense	probably benign	0.00
R8166:Atp10a	UTSW	7	58807522	missense	possibly damaging	0.46
R8201:Atp10a	UTSW	7	58819676	nonsense	probably null
Z1176:Atp10a	UTSW	7	58788447	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- TCACTATCCACAAGTCTGTTCATAG -3'
(R):5'- TTGACAAGCTCCCACTGCTG -3'

Sequencing Primer
(F):5'- TCCACAAGTCTGTTCATAGTTAAAAC -3'
(R):5'- CTGCTGACAGGATCTTACAAATTAC -3'

Posted On

2018-11-28