Incidental Mutation 'R6975:Zfp276'
ID542422
Institutional Source Beutler Lab
Gene Symbol Zfp276
Ensembl Gene ENSMUSG00000001065
Gene Namezinc finger protein (C2H2 type) 276
SynonymsD8Ertd370e, D8Ertd377e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock #R6975 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location123254195-123269745 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 123256831 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 324 (C324*)
Ref Sequence ENSEMBL: ENSMUSP00000001092 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001092] [ENSMUST00000117643] [ENSMUST00000118279] [ENSMUST00000122363] [ENSMUST00000127664] [ENSMUST00000154450] [ENSMUST00000155869]
Predicted Effect probably null
Transcript: ENSMUST00000001092
AA Change: C324*
SMART Domains Protein: ENSMUSP00000001092
Gene: ENSMUSG00000001065
AA Change: C324*

DomainStartEndE-ValueType
low complexity region 18 41 N/A INTRINSIC
low complexity region 59 72 N/A INTRINSIC
Pfam:zf-AD 79 159 1.2e-13 PFAM
low complexity region 402 422 N/A INTRINSIC
ZnF_C2H2 434 458 2.24e-3 SMART
ZnF_C2H2 465 490 6.67e-2 SMART
ZnF_C2H2 496 518 1.38e-3 SMART
ZnF_C2H2 524 546 1.82e-3 SMART
ZnF_C2H2 554 577 4.79e-3 SMART
low complexity region 586 602 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117643
SMART Domains Protein: ENSMUSP00000113748
Gene: ENSMUSG00000001062

DomainStartEndE-ValueType
low complexity region 96 108 N/A INTRINSIC
coiled coil region 187 220 N/A INTRINSIC
low complexity region 266 279 N/A INTRINSIC
low complexity region 442 453 N/A INTRINSIC
Pfam:VPS9 528 645 8.5e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118279
SMART Domains Protein: ENSMUSP00000113634
Gene: ENSMUSG00000001062

DomainStartEndE-ValueType
low complexity region 96 108 N/A INTRINSIC
coiled coil region 187 220 N/A INTRINSIC
low complexity region 266 279 N/A INTRINSIC
low complexity region 442 453 N/A INTRINSIC
Pfam:VPS9 528 645 1.2e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122363
SMART Domains Protein: ENSMUSP00000113575
Gene: ENSMUSG00000001062

DomainStartEndE-ValueType
low complexity region 96 108 N/A INTRINSIC
coiled coil region 187 220 N/A INTRINSIC
low complexity region 266 279 N/A INTRINSIC
low complexity region 442 453 N/A INTRINSIC
Pfam:VPS9 528 644 5.6e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154450
SMART Domains Protein: ENSMUSP00000119771
Gene: ENSMUSG00000001065

DomainStartEndE-ValueType
low complexity region 18 41 N/A INTRINSIC
low complexity region 59 72 N/A INTRINSIC
Pfam:zf-AD 79 159 1.9e-14 PFAM
low complexity region 183 203 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155869
SMART Domains Protein: ENSMUSP00000122184
Gene: ENSMUSG00000001062

DomainStartEndE-ValueType
low complexity region 96 108 N/A INTRINSIC
coiled coil region 187 223 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.9%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,294,057 H100L probably benign Het
Apaf1 A T 10: 91,020,734 H870Q probably damaging Het
Aplf T C 6: 87,646,086 D358G probably damaging Het
Atp10a A T 7: 58,773,985 S233C probably damaging Het
BC022687 C T 12: 112,809,597 P70L possibly damaging Het
Ccdc158 A T 5: 92,666,720 Y82* probably null Het
Cubn T C 2: 13,486,789 D149G probably damaging Het
Cyp4f14 T C 17: 32,914,634 T83A probably benign Het
Endog A G 2: 30,171,636 probably benign Het
Extl3 T C 14: 65,066,797 E721G probably benign Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gcn1l1 A G 5: 115,613,459 H2033R probably damaging Het
Gm12830 T C 4: 114,845,049 M136T Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gm6871 T C 7: 41,546,778 silent Het
Hoxc4 T C 15: 103,035,672 S159P probably damaging Het
Igf2bp2 T A 16: 22,061,861 Q494L probably null Het
Igfn1 T A 1: 135,968,445 N1461I probably damaging Het
Il23r C A 6: 67,423,368 K659N probably damaging Het
Map3k11 A G 19: 5,690,727 S161G possibly damaging Het
Naip6 T A 13: 100,316,265 Q96L probably damaging Het
Nup133 T C 8: 123,915,318 E802G probably damaging Het
Nutm1 G A 2: 112,256,218 S56F probably damaging Het
Olfr248 T A 1: 174,391,677 S203T probably benign Het
Olfr645 T C 7: 104,084,795 N95S probably benign Het
Otop2 A T 11: 115,329,326 S331C possibly damaging Het
Pkd1l3 A G 8: 109,660,907 R1818G possibly damaging Het
Pms1 A T 1: 53,189,431 I886N probably damaging Het
Pnpla6 A G 8: 3,538,068 Y1107C probably damaging Het
Ppp3ca A G 3: 136,905,301 T362A probably damaging Het
Rarb A G 14: 16,574,942 S25P possibly damaging Het
Rnf121 A T 7: 102,024,011 probably null Het
Sae1 T C 7: 16,336,787 Y266C probably damaging Het
Scpep1 A T 11: 88,947,205 F85L probably damaging Het
Shank1 T A 7: 44,313,106 probably null Het
Slc40a1 T C 1: 45,909,492 K543E probably benign Het
Slc9a9 A G 9: 94,960,446 Y350C probably damaging Het
Sun2 G T 15: 79,734,219 Y246* probably null Het
Tas1r2 T A 4: 139,669,720 I790N probably damaging Het
Tmtc2 T C 10: 105,323,002 T577A probably benign Het
Trim24 T G 6: 37,919,492 probably null Het
Ttc12 A G 9: 49,438,418 V693A probably benign Het
Ttc30a2 T C 2: 75,976,408 R587G probably damaging Het
Ttc30a2 A T 2: 75,977,660 Y169* probably null Het
Zbtb22 A C 17: 33,917,964 D361A probably damaging Het
Zfp536 A G 7: 37,568,527 L488P probably damaging Het
Other mutations in Zfp276
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00726:Zfp276 APN 8 123258337 missense probably benign 0.01
IGL02573:Zfp276 APN 8 123264997 missense probably damaging 1.00
IGL02729:Zfp276 APN 8 123267816 missense probably damaging 1.00
IGL02956:Zfp276 APN 8 123254744 missense probably damaging 1.00
IGL03019:Zfp276 APN 8 123267934 missense probably damaging 1.00
R0087:Zfp276 UTSW 8 123265047 missense probably damaging 1.00
R0386:Zfp276 UTSW 8 123259503 nonsense probably null
R1084:Zfp276 UTSW 8 123254723 missense probably damaging 0.99
R4199:Zfp276 UTSW 8 123267825 missense probably damaging 1.00
R4506:Zfp276 UTSW 8 123264927 critical splice donor site probably null
R4584:Zfp276 UTSW 8 123268406 utr 3 prime probably benign
R4776:Zfp276 UTSW 8 123254884 missense probably benign
R4985:Zfp276 UTSW 8 123267907 missense probably damaging 1.00
R5017:Zfp276 UTSW 8 123264977 unclassified probably benign
R5018:Zfp276 UTSW 8 123264977 unclassified probably benign
R5115:Zfp276 UTSW 8 123264977 unclassified probably benign
R5116:Zfp276 UTSW 8 123264977 unclassified probably benign
R5412:Zfp276 UTSW 8 123255781 missense probably damaging 1.00
R5436:Zfp276 UTSW 8 123265282 unclassified probably benign
R5822:Zfp276 UTSW 8 123255718 missense probably benign
R6059:Zfp276 UTSW 8 123267823 missense probably damaging 1.00
R6186:Zfp276 UTSW 8 123255933 nonsense probably null
R6947:Zfp276 UTSW 8 123254904 missense probably benign
R7313:Zfp276 UTSW 8 123267823 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATTAGCAGTGAAATGGGCGTG -3'
(R):5'- TAGGTTCTAGGGGAAGGCAC -3'

Sequencing Primer
(F):5'- TGGGGCAAGGACCTGTCAC -3'
(R):5'- TCTAGGGGAAGGCACCGAGG -3'
Posted On2018-11-28