Mutagenetix > Incidental Mutations

Incidental Mutation 'R6975:Nup133'

542423

Institutional Source

Beutler Lab

Gene Symbol

Nup133

Ensembl Gene

ENSMUSG00000039509

Gene Name

nucleoporin 133

Synonyms

mermaid, 4832420O05Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6975 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

123897123-123949265 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 123915318 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 802 (E802G)

Ref Sequence

ENSEMBL: ENSMUSP00000048084 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044795] [ENSMUST00000127664]

Predicted Effect

probably damaging
Transcript: ENSMUST00000044795
AA Change: E802G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000048084
Gene: ENSMUSG00000039509
AA Change: E802G

Domain	Start	End	E-Value	Type
low complexity region	8	19	N/A	INTRINSIC
PDB:1XKS\|A	66	513	N/A	PDB
Pfam:Nucleoporin_C	593	1052	1.2e-26	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000127664

SMART Domains

Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

Domain	Start	End	E-Value	Type
Pfam:Glycos_transf_2	104	287	7.4e-31	PFAM
Pfam:Glyco_transf_7C	261	331	4.9e-8	PFAM
RICIN	406	531	9.28e-27	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 96.9%

Validation Efficiency

100% (46/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear envelope creates distinct nuclear and cytoplasmic compartments in eukaryotic cells. It consists of two concentric membranes perforated by nuclear pores, large protein complexes that form aqueous channels to regulate the flow of macromolecules between the nucleus and the cytoplasm. These complexes are composed of at least 100 different polypeptide subunits, many of which belong to the nucleoporin family. The nucleoporin protein encoded by this gene displays evolutionarily conserved interactions with other nucleoporins. This protein, which localizes to both sides of the nuclear pore complex at interphase, remains associated with the complex during mitosis and is targeted at early stages to the reforming nuclear envelope. This protein also localizes to kinetochores of mitotic cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit embryonic lethality prior to E10.5, abnormal somitogenesis, pericardial edema, growth retardation, and abnormal neural development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010315B03Rik	T	A	9: 124,294,057	H100L	probably benign	Het
Apaf1	A	T	10: 91,020,734	H870Q	probably damaging	Het
Aplf	T	C	6: 87,646,086	D358G	probably damaging	Het
Atp10a	A	T	7: 58,773,985	S233C	probably damaging	Het
BC022687	C	T	12: 112,809,597	P70L	possibly damaging	Het
Ccdc158	A	T	5: 92,666,720	Y82*	probably null	Het
Cubn	T	C	2: 13,486,789	D149G	probably damaging	Het
Cyp4f14	T	C	17: 32,914,634	T83A	probably benign	Het
Endog	A	G	2: 30,171,636		probably benign	Het
Extl3	T	C	14: 65,066,797	E721G	probably benign	Het
Gatad1	T	C	5: 3,643,540	R210G	probably benign	Het
Gcn1l1	A	G	5: 115,613,459	H2033R	probably damaging	Het
Gm12830	T	C	4: 114,845,049	M136T		Het
Gm15922	C	G	7: 3,737,320	A301P	probably damaging	Het
Gm6871	T	C	7: 41,546,778		silent	Het
Hoxc4	T	C	15: 103,035,672	S159P	probably damaging	Het
Igf2bp2	T	A	16: 22,061,861	Q494L	probably null	Het
Igfn1	T	A	1: 135,968,445	N1461I	probably damaging	Het
Il23r	C	A	6: 67,423,368	K659N	probably damaging	Het
Map3k11	A	G	19: 5,690,727	S161G	possibly damaging	Het
Naip6	T	A	13: 100,316,265	Q96L	probably damaging	Het
Nutm1	G	A	2: 112,256,218	S56F	probably damaging	Het
Olfr248	T	A	1: 174,391,677	S203T	probably benign	Het
Olfr645	T	C	7: 104,084,795	N95S	probably benign	Het
Otop2	A	T	11: 115,329,326	S331C	possibly damaging	Het
Pkd1l3	A	G	8: 109,660,907	R1818G	possibly damaging	Het
Pms1	A	T	1: 53,189,431	I886N	probably damaging	Het
Pnpla6	A	G	8: 3,538,068	Y1107C	probably damaging	Het
Ppp3ca	A	G	3: 136,905,301	T362A	probably damaging	Het
Rarb	A	G	14: 16,574,942	S25P	possibly damaging	Het
Rnf121	A	T	7: 102,024,011		probably null	Het
Sae1	T	C	7: 16,336,787	Y266C	probably damaging	Het
Scpep1	A	T	11: 88,947,205	F85L	probably damaging	Het
Shank1	T	A	7: 44,313,106		probably null	Het
Slc40a1	T	C	1: 45,909,492	K543E	probably benign	Het
Slc9a9	A	G	9: 94,960,446	Y350C	probably damaging	Het
Sun2	G	T	15: 79,734,219	Y246*	probably null	Het
Tas1r2	T	A	4: 139,669,720	I790N	probably damaging	Het
Tmtc2	T	C	10: 105,323,002	T577A	probably benign	Het
Trim24	T	G	6: 37,919,492		probably null	Het
Ttc12	A	G	9: 49,438,418	V693A	probably benign	Het
Ttc30a2	A	T	2: 75,977,660	Y169*	probably null	Het
Ttc30a2	T	C	2: 75,976,408	R587G	probably damaging	Het
Zbtb22	A	C	17: 33,917,964	D361A	probably damaging	Het
Zfp276	T	A	8: 123,256,831	C324*	probably null	Het
Zfp536	A	G	7: 37,568,527	L488P	probably damaging	Het

Other mutations in Nup133

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00470:Nup133	APN	8	123939083	missense	probably damaging	0.98
IGL00507:Nup133	APN	8	123918967	nonsense	probably null
IGL00585:Nup133	APN	8	123909994	missense	probably damaging	1.00
IGL00676:Nup133	APN	8	123906298	intron	probably benign
IGL00966:Nup133	APN	8	123911906	missense	probably damaging	0.98
IGL01069:Nup133	APN	8	123930982	nonsense	probably null
IGL01553:Nup133	APN	8	123915324	missense	possibly damaging	0.58
IGL01669:Nup133	APN	8	123939130	nonsense	probably null
IGL01730:Nup133	APN	8	123938233	missense	probably benign	0.00
IGL01996:Nup133	APN	8	123946595	missense	probably benign	0.00
IGL02332:Nup133	APN	8	123907832	missense	probably damaging	1.00
IGL02552:Nup133	APN	8	123929255	missense	possibly damaging	0.75
IGL02956:Nup133	APN	8	123949083	missense	probably benign	0.00
IGL03009:Nup133	APN	8	123933500	missense	possibly damaging	0.46
IGL03036:Nup133	APN	8	123946594	missense	probably benign	0.11
Slant	UTSW	8	123916281	splice site	probably null
R0010:Nup133	UTSW	8	123904579	missense	probably damaging	1.00
R0010:Nup133	UTSW	8	123904579	missense	probably damaging	1.00
R0139:Nup133	UTSW	8	123929343	missense	probably benign	0.00
R0344:Nup133	UTSW	8	123917446	missense	possibly damaging	0.82
R0730:Nup133	UTSW	8	123949008	missense	probably benign	0.00
R1301:Nup133	UTSW	8	123917417	intron	probably benign
R1453:Nup133	UTSW	8	123915375	missense	probably benign	0.00
R1570:Nup133	UTSW	8	123949176	start codon destroyed	possibly damaging	0.82
R1607:Nup133	UTSW	8	123949035	missense	probably benign	0.02
R1773:Nup133	UTSW	8	123930983	nonsense	probably null
R1992:Nup133	UTSW	8	123906221	missense	possibly damaging	0.80
R2062:Nup133	UTSW	8	123914575	missense	probably damaging	1.00
R2065:Nup133	UTSW	8	123914575	missense	probably damaging	1.00
R2066:Nup133	UTSW	8	123914575	missense	probably damaging	1.00
R2068:Nup133	UTSW	8	123914575	missense	probably damaging	1.00
R4397:Nup133	UTSW	8	123944301	missense	probably benign	0.04
R4683:Nup133	UTSW	8	123930982	nonsense	probably null
R4771:Nup133	UTSW	8	123929398	missense	probably damaging	1.00
R4910:Nup133	UTSW	8	123927131	missense	possibly damaging	0.91
R4911:Nup133	UTSW	8	123927131	missense	possibly damaging	0.91
R4968:Nup133	UTSW	8	123915196	missense	probably benign	0.07
R5411:Nup133	UTSW	8	123927206	missense	probably benign
R5470:Nup133	UTSW	8	123930966	missense	probably benign	0.00
R5664:Nup133	UTSW	8	123906281	missense	probably benign	0.01
R5907:Nup133	UTSW	8	123916299	missense	possibly damaging	0.90
R6003:Nup133	UTSW	8	123938292	missense	probably damaging	0.98
R6059:Nup133	UTSW	8	123914596	missense	probably damaging	1.00
R6219:Nup133	UTSW	8	123936873	missense	possibly damaging	0.90
R6292:Nup133	UTSW	8	123917437	missense	probably benign	0.01
R6672:Nup133	UTSW	8	123916281	splice site	probably null
R6737:Nup133	UTSW	8	123906291	missense	probably damaging	0.99
R6763:Nup133	UTSW	8	123944278	missense	possibly damaging	0.95
R6870:Nup133	UTSW	8	123899507	missense	probably benign	0.08
R7101:Nup133	UTSW	8	123906227	missense	possibly damaging	0.89
R7114:Nup133	UTSW	8	123915373	missense	probably benign	0.00
R7271:Nup133	UTSW	8	123922414	missense	probably benign	0.34
R7501:Nup133	UTSW	8	123922414	missense	probably benign	0.34
R8054:Nup133	UTSW	8	123949217	intron	probably benign
R8397:Nup133	UTSW	8	123922417	missense	probably benign	0.17
R8703:Nup133	UTSW	8	123916282	critical splice donor site	probably null
R8811:Nup133	UTSW	8	123911888	frame shift	probably null
R8813:Nup133	UTSW	8	123911888	frame shift	probably null
X0023:Nup133	UTSW	8	123909988	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GACTAACTGCACCTCTCCAG -3'
(R):5'- TCCTAGAGCAGTGAGGAAGC -3'

Sequencing Primer
(F):5'- GCTCCACCCGTTGTGCATG -3'
(R):5'- CAGTGAGGAAGCCTGATTTTCAG -3'

Posted On

2018-11-28