Incidental Mutation 'R6975:Ttc12'
ID542424
Institutional Source Beutler Lab
Gene Symbol Ttc12
Ensembl Gene ENSMUSG00000040219
Gene Nametetratricopeptide repeat domain 12
SynonymsE330017O07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R6975 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location49436963-49486225 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 49438418 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 693 (V693A)
Ref Sequence ENSEMBL: ENSMUSP00000056378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055096]
Predicted Effect probably benign
Transcript: ENSMUST00000055096
AA Change: V693A

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000056378
Gene: ENSMUSG00000040219
AA Change: V693A

DomainStartEndE-ValueType
coiled coil region 1 29 N/A INTRINSIC
low complexity region 88 102 N/A INTRINSIC
TPR 105 138 9.39e-1 SMART
TPR 139 172 1.97e-3 SMART
TPR 173 206 1.09e-5 SMART
low complexity region 356 368 N/A INTRINSIC
low complexity region 602 613 N/A INTRINSIC
Blast:ARM 634 675 1e-7 BLAST
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.9%
Validation Efficiency 100% (46/46)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T A 9: 124,294,057 H100L probably benign Het
Apaf1 A T 10: 91,020,734 H870Q probably damaging Het
Aplf T C 6: 87,646,086 D358G probably damaging Het
Atp10a A T 7: 58,773,985 S233C probably damaging Het
BC022687 C T 12: 112,809,597 P70L possibly damaging Het
Ccdc158 A T 5: 92,666,720 Y82* probably null Het
Cubn T C 2: 13,486,789 D149G probably damaging Het
Cyp4f14 T C 17: 32,914,634 T83A probably benign Het
Endog A G 2: 30,171,636 probably benign Het
Extl3 T C 14: 65,066,797 E721G probably benign Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gcn1l1 A G 5: 115,613,459 H2033R probably damaging Het
Gm12830 T C 4: 114,845,049 M136T Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gm6871 T C 7: 41,546,778 silent Het
Hoxc4 T C 15: 103,035,672 S159P probably damaging Het
Igf2bp2 T A 16: 22,061,861 Q494L probably null Het
Igfn1 T A 1: 135,968,445 N1461I probably damaging Het
Il23r C A 6: 67,423,368 K659N probably damaging Het
Map3k11 A G 19: 5,690,727 S161G possibly damaging Het
Naip6 T A 13: 100,316,265 Q96L probably damaging Het
Nup133 T C 8: 123,915,318 E802G probably damaging Het
Nutm1 G A 2: 112,256,218 S56F probably damaging Het
Olfr248 T A 1: 174,391,677 S203T probably benign Het
Olfr645 T C 7: 104,084,795 N95S probably benign Het
Otop2 A T 11: 115,329,326 S331C possibly damaging Het
Pkd1l3 A G 8: 109,660,907 R1818G possibly damaging Het
Pms1 A T 1: 53,189,431 I886N probably damaging Het
Pnpla6 A G 8: 3,538,068 Y1107C probably damaging Het
Ppp3ca A G 3: 136,905,301 T362A probably damaging Het
Rarb A G 14: 16,574,942 S25P possibly damaging Het
Rnf121 A T 7: 102,024,011 probably null Het
Sae1 T C 7: 16,336,787 Y266C probably damaging Het
Scpep1 A T 11: 88,947,205 F85L probably damaging Het
Shank1 T A 7: 44,313,106 probably null Het
Slc40a1 T C 1: 45,909,492 K543E probably benign Het
Slc9a9 A G 9: 94,960,446 Y350C probably damaging Het
Sun2 G T 15: 79,734,219 Y246* probably null Het
Tas1r2 T A 4: 139,669,720 I790N probably damaging Het
Tmtc2 T C 10: 105,323,002 T577A probably benign Het
Trim24 T G 6: 37,919,492 probably null Het
Ttc30a2 T C 2: 75,976,408 R587G probably damaging Het
Ttc30a2 A T 2: 75,977,660 Y169* probably null Het
Zbtb22 A C 17: 33,917,964 D361A probably damaging Het
Zfp276 T A 8: 123,256,831 C324* probably null Het
Zfp536 A G 7: 37,568,527 L488P probably damaging Het
Other mutations in Ttc12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Ttc12 APN 9 49471206 splice site probably null
IGL01300:Ttc12 APN 9 49447922 splice site probably benign
IGL02100:Ttc12 APN 9 49440182 missense probably damaging 1.00
IGL03106:Ttc12 APN 9 49458062 missense possibly damaging 0.75
I2288:Ttc12 UTSW 9 49470258 missense possibly damaging 0.62
R1238:Ttc12 UTSW 9 49458187 splice site probably benign
R1712:Ttc12 UTSW 9 49445199 missense probably benign
R1725:Ttc12 UTSW 9 49458115 missense probably benign 0.08
R1824:Ttc12 UTSW 9 49456884 missense probably damaging 1.00
R1916:Ttc12 UTSW 9 49460398 missense probably damaging 1.00
R2226:Ttc12 UTSW 9 49441835 critical splice donor site probably null
R4498:Ttc12 UTSW 9 49472405 missense probably damaging 1.00
R5920:Ttc12 UTSW 9 49453333 missense possibly damaging 0.48
R6020:Ttc12 UTSW 9 49443122 missense probably damaging 0.96
R6687:Ttc12 UTSW 9 49438418 missense probably benign 0.08
R6755:Ttc12 UTSW 9 49453346 missense probably benign 0.00
R7349:Ttc12 UTSW 9 49447967 missense possibly damaging 0.94
R7357:Ttc12 UTSW 9 49438387 missense probably benign 0.02
R7451:Ttc12 UTSW 9 49471879 missense probably benign 0.00
R7725:Ttc12 UTSW 9 49440302 missense probably benign 0.00
R7842:Ttc12 UTSW 9 49438424 missense possibly damaging 0.80
R7925:Ttc12 UTSW 9 49438424 missense possibly damaging 0.80
R8029:Ttc12 UTSW 9 49470251 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- CGGCAGACATCCAGTTTTGG -3'
(R):5'- ACACTGAGTGTTCCCAGTATTGTG -3'

Sequencing Primer
(F):5'- gtgtgtgtgtgtgtgtgt -3'
(R):5'- TGTGGGTTCCCCTAGAGTCC -3'
Posted On2018-11-28