Mutagenetix > Incidental Mutation

Incidental Mutation 'R6976:Plcb1'

542447

Institutional Source

Beutler Lab

Gene Symbol

Plcb1

Ensembl Gene

ENSMUSG00000051177

Gene Name

phospholipase C, beta 1

Synonyms

3110043I21Rik

MMRRC Submission

045382-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.201) question?

Stock #

R6976 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

134786067-135475258 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 135262239 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 276 (E276G)

Ref Sequence

ENSEMBL: ENSMUSP00000118756 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070724] [ENSMUST00000110116] [ENSMUST00000131552]

AlphaFold

Q9Z1B3

Predicted Effect

possibly damaging
Transcript: ENSMUST00000070724
AA Change: E276G

PolyPhen 2 Score 0.749 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000064844
Gene: ENSMUSG00000051177
AA Change: E276G

Domain	Start	End	E-Value	Type
Pfam:EF-hand_like	224	315	2.2e-26	PFAM
PLCXc	316	467	2.85e-74	SMART
low complexity region	491	501	N/A	INTRINSIC
PLCYc	540	656	2e-69	SMART
C2	677	776	1.55e-12	SMART
low complexity region	871	885	N/A	INTRINSIC
Pfam:DUF1154	903	946	1.3e-7	PFAM
low complexity region	967	984	N/A	INTRINSIC
Pfam:PLC-beta_C	997	1155	1.9e-64	PFAM
low complexity region	1157	1168	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110116
AA Change: E276G

PolyPhen 2 Score 0.645 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000105743
Gene: ENSMUSG00000051177
AA Change: E276G

Domain	Start	End	E-Value	Type
Pfam:EF-hand_like	224	315	4.1e-26	PFAM
PLCXc	316	467	2.85e-74	SMART
low complexity region	491	501	N/A	INTRINSIC
PLCYc	540	656	2e-69	SMART
C2	677	776	1.55e-12	SMART
low complexity region	871	885	N/A	INTRINSIC
Pfam:DUF1154	903	946	1.1e-9	PFAM
low complexity region	967	984	N/A	INTRINSIC
Pfam:PLC-beta_C	1003	1176	2.9e-61	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000131552
AA Change: E276G

PolyPhen 2 Score 0.749 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000118756
Gene: ENSMUSG00000051177
AA Change: E276G

Domain	Start	End	E-Value	Type
Pfam:EF-hand_like	224	315	3.9e-26	PFAM
PLCXc	316	467	2.85e-74	SMART
low complexity region	491	501	N/A	INTRINSIC
PLCYc	540	656	2e-69	SMART
C2	677	776	1.55e-12	SMART
low complexity region	871	885	N/A	INTRINSIC
Pfam:DUF1154	903	946	1e-9	PFAM
low complexity region	967	984	N/A	INTRINSIC
Pfam:PLC-beta_C	1003	1148	8e-51	PFAM
low complexity region	1157	1168	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000201485

Meta Mutation Damage Score

0.3292

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.9%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the formation of inositol 1,4,5-trisphosphate and diacylglycerol from phosphatidylinositol 4,5-bisphosphate. This reaction uses calcium as a cofactor and plays an important role in the intracellular transduction of many extracellular signals. This gene is activated by two G-protein alpha subunits, alpha-q and alpha-11. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit spontaneous seizures and high mortality around 3 weeks of age. Mutant males show exhibit sperm with a reduced acrosome reaction rate and fertilizing capacity in vitro and decreased fertility in vivo. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acss2	T	A	2: 155,556,009		probably null	Het
Adamts4	G	T	1: 171,252,308		probably benign	Het
Adgrv1	T	A	13: 81,520,997	K2480M	probably damaging	Het
Ankhd1	A	C	18: 36,648,254	S2120R	probably benign	Het
Ash1l	T	A	3: 88,981,657	V281E	possibly damaging	Het
Bdh1	G	A	16: 31,438,029	A35T	probably benign	Het
Brpf3	A	G	17: 28,835,777	M1098V	probably damaging	Het
Cel	G	A	2: 28,556,842	S439F	probably damaging	Het
Dnah11	T	C	12: 118,198,643	S64G	probably benign	Het
Dpp7	T	C	2: 25,354,824		probably null	Het
Fam83c	T	A	2: 155,830,237	Y426F	possibly damaging	Het
Fasn	A	G	11: 120,819,867	I322T	probably damaging	Het
Glod4	A	G	11: 76,243,580	F22S	probably damaging	Het
Gm3127	A	G	14: 4,172,441	T231A	possibly damaging	Het
Gm49383	A	G	12: 69,196,956	S444P	possibly damaging	Het
Gnaz	T	C	10: 74,991,436	S7P	possibly damaging	Het
Grin2b	C	T	6: 135,780,200	S421N	probably benign	Het
Grm1	T	C	10: 10,689,180	D1128G	probably benign	Het
Hoxb13	A	G	11: 96,196,218	T284A	probably benign	Het
Il9r	G	A	11: 32,193,177	Q260*	probably null	Het
Lrrfip1	T	A	1: 91,115,015	C381S	probably benign	Het
Mitd1	A	T	1: 37,882,697	D85E	probably benign	Het
Muc4	G	A	16: 32,762,518	D2556N	possibly damaging	Het
Nlrc4	A	G	17: 74,445,939	I483T	probably damaging	Het
Olfr699	A	T	7: 106,790,227	M258K	probably damaging	Het
Olfr70	A	G	4: 43,697,170	M1T	probably null	Het
Olfr967	A	G	9: 39,751,244	N286S	probably damaging	Het
Pcdhb7	C	A	18: 37,343,578	A589E	probably benign	Het
Pcdhgb5	G	A	18: 37,731,268	E39K	probably damaging	Het
Pja2	T	C	17: 64,308,959	K314E	probably damaging	Het
Ppp2r5c	A	G	12: 110,544,145	E122G	probably damaging	Het
Prrc2c	A	T	1: 162,692,844	N732K	probably damaging	Het
Rb1cc1	T	A	1: 6,262,902	D1348E	probably benign	Het
Sh3rf1	G	T	8: 61,361,732	E442*	probably null	Het
Snapc1	A	G	12: 73,970,200	D204G	probably damaging	Het
Sry	C	T	Y: 2,662,938	D241N	unknown	Het
Strn4	T	A	7: 16,830,354	M303K	probably benign	Het
Tas2r118	A	G	6: 23,969,471	I197T	probably benign	Het
Tnni3k	A	G	3: 154,792,776	Y809H	probably benign	Het
Tnpo3	A	T	6: 29,572,595	C419*	probably null	Het
Trpm6	T	C	19: 18,783,163	S143P	probably benign	Het
Ttc23l	A	T	15: 10,537,580	C201*	probably null	Het
Ubr4	A	G	4: 139,393,077	N271S	probably damaging	Het
Vmn1r70	T	C	7: 10,634,044	M134T	probably benign	Het
Vmn2r27	C	T	6: 124,224,353	W215*	probably null	Het
Xirp1	A	T	9: 120,017,918	M633K	probably damaging	Het
Zfp174	T	C	16: 3,847,940	I23T	possibly damaging	Het
Zfp536	T	A	7: 37,480,403	S926C	probably damaging	Het
Zfp943	T	C	17: 21,990,941	S65P	possibly damaging	Het

Other mutations in Plcb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00510:Plcb1	APN	2	135251756	missense	possibly damaging	0.66
IGL01152:Plcb1	APN	2	134813659	missense	probably damaging	1.00
IGL01945:Plcb1	APN	2	135220791	missense	probably benign	0.03
IGL01999:Plcb1	APN	2	135346318	missense	probably damaging	1.00
IGL02109:Plcb1	APN	2	134786559	missense	probably damaging	1.00
IGL02153:Plcb1	APN	2	135387853	missense	probably benign	0.08
IGL02207:Plcb1	APN	2	135387171	missense	probably damaging	1.00
IGL02566:Plcb1	APN	2	135472263	missense	probably benign	0.17
IGL02590:Plcb1	APN	2	135294864	missense	probably benign	0.08
IGL02640:Plcb1	APN	2	135220859	splice site	probably benign
IGL02926:Plcb1	APN	2	135364762	splice site	probably benign
IGL03071:Plcb1	APN	2	135387802	missense	probably damaging	1.00
IGL03236:Plcb1	APN	2	135346306	missense	probably damaging	1.00
IGL03252:Plcb1	APN	2	135370428	missense	probably benign
IGL03387:Plcb1	APN	2	134813686	splice site	probably benign
BB001:Plcb1	UTSW	2	135359693	missense	probably benign	0.00
BB011:Plcb1	UTSW	2	135359693	missense	probably benign	0.00
R0024:Plcb1	UTSW	2	135362425	missense	probably benign	0.06
R0024:Plcb1	UTSW	2	135362425	missense	probably benign	0.06
R0053:Plcb1	UTSW	2	135294915	missense	probably benign	0.33
R0053:Plcb1	UTSW	2	135294915	missense	probably benign	0.33
R0308:Plcb1	UTSW	2	134813614	missense	probably benign	0.01
R0415:Plcb1	UTSW	2	135337499	missense	probably damaging	1.00
R0624:Plcb1	UTSW	2	135294911	missense	possibly damaging	0.81
R0898:Plcb1	UTSW	2	135387143	missense	possibly damaging	0.73
R1071:Plcb1	UTSW	2	135325657	missense	possibly damaging	0.64
R1615:Plcb1	UTSW	2	135362444	splice site	probably benign
R1617:Plcb1	UTSW	2	135337441	missense	probably damaging	1.00
R1785:Plcb1	UTSW	2	135325667	nonsense	probably null
R1866:Plcb1	UTSW	2	135344173	missense	probably benign	0.01
R1869:Plcb1	UTSW	2	135311014	missense	probably benign	0.02
R1902:Plcb1	UTSW	2	134813613	missense	possibly damaging	0.93
R1938:Plcb1	UTSW	2	135386302	missense	probably damaging	1.00
R2016:Plcb1	UTSW	2	135362420	missense	possibly damaging	0.94
R2017:Plcb1	UTSW	2	135362420	missense	possibly damaging	0.94
R2131:Plcb1	UTSW	2	135325667	nonsense	probably null
R2132:Plcb1	UTSW	2	135325667	nonsense	probably null
R2133:Plcb1	UTSW	2	135325667	nonsense	probably null
R2164:Plcb1	UTSW	2	135346330	missense	possibly damaging	0.87
R2419:Plcb1	UTSW	2	135262100	splice site	probably benign
R2429:Plcb1	UTSW	2	135337442	missense	probably damaging	0.99
R2508:Plcb1	UTSW	2	135260508	missense	probably benign	0.27
R3161:Plcb1	UTSW	2	135335482	missense	probably benign	0.03
R3870:Plcb1	UTSW	2	135325671	missense	probably damaging	0.99
R4191:Plcb1	UTSW	2	135345090	missense	probably damaging	1.00
R4239:Plcb1	UTSW	2	135344158	missense	probably damaging	0.99
R4552:Plcb1	UTSW	2	135335493	missense	probably benign	0.44
R4553:Plcb1	UTSW	2	135335493	missense	probably benign	0.44
R4720:Plcb1	UTSW	2	135251747	missense	possibly damaging	0.70
R4946:Plcb1	UTSW	2	135345095	missense	probably benign	0.01
R5012:Plcb1	UTSW	2	135333400	missense	probably null	0.97
R5151:Plcb1	UTSW	2	135262245	missense	probably benign	0.28
R5320:Plcb1	UTSW	2	135252776	missense	possibly damaging	0.56
R5415:Plcb1	UTSW	2	135347402	missense	possibly damaging	0.67
R5523:Plcb1	UTSW	2	135260566	missense	probably benign	0.08
R5568:Plcb1	UTSW	2	135370593	missense	probably damaging	1.00
R5688:Plcb1	UTSW	2	135335480	missense	probably benign	0.06
R5809:Plcb1	UTSW	2	135262244	missense	possibly damaging	0.83
R6237:Plcb1	UTSW	2	135370566	missense	possibly damaging	0.94
R6315:Plcb1	UTSW	2	135346341	missense	probably benign	0.00
R6478:Plcb1	UTSW	2	135335451	missense	probably damaging	1.00
R6531:Plcb1	UTSW	2	135325802	critical splice donor site	probably null
R6683:Plcb1	UTSW	2	134786593	missense	probably benign	0.32
R6760:Plcb1	UTSW	2	135472060	missense	possibly damaging	0.50
R6947:Plcb1	UTSW	2	135386155	missense	probably benign	0.08
R7379:Plcb1	UTSW	2	135370510	missense	probably benign	0.45
R7473:Plcb1	UTSW	2	135344276	missense	probably damaging	0.98
R7492:Plcb1	UTSW	2	135251764	nonsense	probably null
R7498:Plcb1	UTSW	2	135262233	nonsense	probably null
R7498:Plcb1	UTSW	2	135262234	missense	probably damaging	0.99
R7777:Plcb1	UTSW	2	135220757	missense	possibly damaging	0.51
R7924:Plcb1	UTSW	2	135359693	missense	probably benign	0.00
R8061:Plcb1	UTSW	2	135346396	missense	probably benign
R8099:Plcb1	UTSW	2	135251734	missense	possibly damaging	0.68
R8299:Plcb1	UTSW	2	135335476	missense	probably damaging	1.00
R8394:Plcb1	UTSW	2	135317790	missense	probably damaging	1.00
R8439:Plcb1	UTSW	2	135250052	critical splice donor site	probably null
R8549:Plcb1	UTSW	2	135364933	missense	probably benign	0.00
R8693:Plcb1	UTSW	2	135252776	missense	probably benign	0.00
R8750:Plcb1	UTSW	2	135335449	missense	probably damaging	1.00
R8817:Plcb1	UTSW	2	135333509	intron	probably benign
R8950:Plcb1	UTSW	2	135337519	missense	probably damaging	1.00
R9146:Plcb1	UTSW	2	135340695	missense	probably damaging	1.00
R9301:Plcb1	UTSW	2	135325690	missense	possibly damaging	0.96
R9311:Plcb1	UTSW	2	135347465	missense	probably benign	0.00
R9459:Plcb1	UTSW	2	135322638	missense	probably benign	0.03
S24628:Plcb1	UTSW	2	135337499	missense	probably damaging	1.00
X0025:Plcb1	UTSW	2	135345054	missense	possibly damaging	0.87
Z1088:Plcb1	UTSW	2	135220846	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- GGAACAGACTGTGATTTCTTCTC -3'
(R):5'- TGGCTTGCACCACAAACAG -3'

Sequencing Primer
(F):5'- AACAGACTGTGATTTCTTCTCTTTCC -3'
(R):5'- GGCTTGCACCACAAACAGAACTC -3'

Posted On

2018-11-28