Incidental Mutation 'R6976:Fam83c'
ID542448
Institutional Source Beutler Lab
Gene Symbol Fam83c
Ensembl Gene ENSMUSG00000074647
Gene Namefamily with sequence similarity 83, member C
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R6976 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location155827548-155834854 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 155830237 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 426 (Y426F)
Ref Sequence ENSEMBL: ENSMUSP00000029143 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029142] [ENSMUST00000029143] [ENSMUST00000109638] [ENSMUST00000129830] [ENSMUST00000134278] [ENSMUST00000154841]
Predicted Effect probably benign
Transcript: ENSMUST00000029142
SMART Domains Protein: ENSMUSP00000029142
Gene: ENSMUSG00000027613

DomainStartEndE-ValueType
eIF6 3 204 2.72e-136 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000029143
AA Change: Y426F

PolyPhen 2 Score 0.625 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000029143
Gene: ENSMUSG00000074647
AA Change: Y426F

DomainStartEndE-ValueType
Pfam:DUF1669 61 337 3.1e-107 PFAM
low complexity region 347 357 N/A INTRINSIC
low complexity region 368 385 N/A INTRINSIC
low complexity region 398 411 N/A INTRINSIC
low complexity region 474 484 N/A INTRINSIC
low complexity region 570 589 N/A INTRINSIC
low complexity region 672 685 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109638
SMART Domains Protein: ENSMUSP00000105266
Gene: ENSMUSG00000027613

DomainStartEndE-ValueType
Pfam:eIF-6 3 70 1.2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129830
SMART Domains Protein: ENSMUSP00000120206
Gene: ENSMUSG00000027613

DomainStartEndE-ValueType
eIF6 3 68 4.5e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134278
SMART Domains Protein: ENSMUSP00000123190
Gene: ENSMUSG00000027613

DomainStartEndE-ValueType
Pfam:eIF-6 1 58 5.1e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154841
SMART Domains Protein: ENSMUSP00000115715
Gene: ENSMUSG00000027613

DomainStartEndE-ValueType
Pfam:eIF-6 3 45 7.8e-10 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 T A 2: 155,556,009 probably null Het
Adamts4 G T 1: 171,252,308 probably benign Het
Adgrv1 T A 13: 81,520,997 K2480M probably damaging Het
Ankhd1 A C 18: 36,648,254 S2120R probably benign Het
Ash1l T A 3: 88,981,657 V281E possibly damaging Het
Bdh1 G A 16: 31,438,029 A35T probably benign Het
Brpf3 A G 17: 28,835,777 M1098V probably damaging Het
Cel G A 2: 28,556,842 S439F probably damaging Het
Dnah11 T C 12: 118,198,643 S64G probably benign Het
Dpp7 T C 2: 25,354,824 probably null Het
Fasn A G 11: 120,819,867 I322T probably damaging Het
Glod4 A G 11: 76,243,580 F22S probably damaging Het
Gm3127 A G 14: 4,172,441 T231A possibly damaging Het
Gm49383 A G 12: 69,196,956 S444P possibly damaging Het
Gnaz T C 10: 74,991,436 S7P possibly damaging Het
Grin2b C T 6: 135,780,200 S421N probably benign Het
Grm1 T C 10: 10,689,180 D1128G probably benign Het
Hoxb13 A G 11: 96,196,218 T284A probably benign Het
Il9r G A 11: 32,193,177 Q260* probably null Het
Lrrfip1 T A 1: 91,115,015 C381S probably benign Het
Mitd1 A T 1: 37,882,697 D85E probably benign Het
Muc4 G A 16: 32,762,518 D2556N possibly damaging Het
Nlrc4 A G 17: 74,445,939 I483T probably damaging Het
Olfr699 A T 7: 106,790,227 M258K probably damaging Het
Olfr70 A G 4: 43,697,170 M1T probably null Het
Olfr967 A G 9: 39,751,244 N286S probably damaging Het
Pcdhb7 C A 18: 37,343,578 A589E probably benign Het
Pcdhgb5 G A 18: 37,731,268 E39K probably damaging Het
Pja2 T C 17: 64,308,959 K314E probably damaging Het
Plcb1 A G 2: 135,262,239 E276G possibly damaging Het
Ppp2r5c A G 12: 110,544,145 E122G probably damaging Het
Prrc2c A T 1: 162,692,844 N732K probably damaging Het
Rb1cc1 T A 1: 6,262,902 D1348E probably benign Het
Sh3rf1 G T 8: 61,361,732 E442* probably null Het
Snapc1 A G 12: 73,970,200 D204G probably damaging Het
Sry C T Y: 2,662,938 D241N unknown Het
Strn4 T A 7: 16,830,354 M303K probably benign Het
Tas2r118 A G 6: 23,969,471 I197T probably benign Het
Tnni3k A G 3: 154,792,776 Y809H probably benign Het
Tnpo3 A T 6: 29,572,595 C419* probably null Het
Trpm6 T C 19: 18,783,163 S143P probably benign Het
Ttc23l A T 15: 10,537,580 C201* probably null Het
Ubr4 A G 4: 139,393,077 N271S probably damaging Het
Vmn1r70 T C 7: 10,634,044 M134T probably benign Het
Vmn2r27 C T 6: 124,224,353 W215* probably null Het
Xirp1 A T 9: 120,017,918 M633K probably damaging Het
Zfp174 T C 16: 3,847,940 I23T possibly damaging Het
Zfp536 T A 7: 37,480,403 S926C probably damaging Het
Zfp943 T C 17: 21,990,941 S65P possibly damaging Het
Other mutations in Fam83c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01303:Fam83c APN 2 155834442 missense probably damaging 1.00
IGL01470:Fam83c APN 2 155834808 missense possibly damaging 0.73
IGL02695:Fam83c APN 2 155831515 missense probably benign 0.04
R0255:Fam83c UTSW 2 155829752 missense probably benign 0.00
R0321:Fam83c UTSW 2 155829700 missense probably benign
R0449:Fam83c UTSW 2 155830295 missense probably benign 0.00
R1596:Fam83c UTSW 2 155831062 critical splice acceptor site probably null
R1635:Fam83c UTSW 2 155830051 missense possibly damaging 0.95
R2006:Fam83c UTSW 2 155830303 missense probably benign 0.04
R2165:Fam83c UTSW 2 155831524 missense possibly damaging 0.94
R3840:Fam83c UTSW 2 155834748 missense probably benign
R3841:Fam83c UTSW 2 155834748 missense probably benign
R4693:Fam83c UTSW 2 155830234 missense probably damaging 1.00
R5660:Fam83c UTSW 2 155829589 missense probably benign 0.08
R6364:Fam83c UTSW 2 155834523 missense probably damaging 1.00
R6563:Fam83c UTSW 2 155830952 missense probably damaging 0.98
R7124:Fam83c UTSW 2 155829571 missense probably benign 0.00
R7643:Fam83c UTSW 2 155831004 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TTCCACTGTCTCCAGAGCTG -3'
(R):5'- TTTGGACCTGCAGTTCCAAGC -3'

Sequencing Primer
(F):5'- ATTCTCTGGAAGCCGGGACAG -3'
(R):5'- AGTTCCAAGCGCCACAGG -3'
Posted On2018-11-28