Incidental Mutation 'R6976:Vmn1r70'
ID542457
Institutional Source Beutler Lab
Gene Symbol Vmn1r70
Ensembl Gene ENSMUSG00000045340
Gene Namevomeronasal 1 receptor 70
SynonymsV1rl1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R6976 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location10631532-10636530 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 10634044 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 134 (M134T)
Ref Sequence ENSEMBL: ENSMUSP00000154793 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055847] [ENSMUST00000226255] [ENSMUST00000228090]
Predicted Effect probably benign
Transcript: ENSMUST00000055847
AA Change: M153T

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000054445
Gene: ENSMUSG00000045340
AA Change: M153T

DomainStartEndE-ValueType
Pfam:TAS2R 1 292 2.6e-9 PFAM
Pfam:V1R 33 295 3.1e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226255
AA Change: M153T

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
Predicted Effect probably benign
Transcript: ENSMUST00000228090
AA Change: M134T

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 T A 2: 155,556,009 probably null Het
Adamts4 G T 1: 171,252,308 probably benign Het
Adgrv1 T A 13: 81,520,997 K2480M probably damaging Het
Ankhd1 A C 18: 36,648,254 S2120R probably benign Het
Ash1l T A 3: 88,981,657 V281E possibly damaging Het
Bdh1 G A 16: 31,438,029 A35T probably benign Het
Brpf3 A G 17: 28,835,777 M1098V probably damaging Het
Cel G A 2: 28,556,842 S439F probably damaging Het
Dnah11 T C 12: 118,198,643 S64G probably benign Het
Dpp7 T C 2: 25,354,824 probably null Het
Fam83c T A 2: 155,830,237 Y426F possibly damaging Het
Fasn A G 11: 120,819,867 I322T probably damaging Het
Glod4 A G 11: 76,243,580 F22S probably damaging Het
Gm3127 A G 14: 4,172,441 T231A possibly damaging Het
Gm49383 A G 12: 69,196,956 S444P possibly damaging Het
Gnaz T C 10: 74,991,436 S7P possibly damaging Het
Grin2b C T 6: 135,780,200 S421N probably benign Het
Grm1 T C 10: 10,689,180 D1128G probably benign Het
Hoxb13 A G 11: 96,196,218 T284A probably benign Het
Il9r G A 11: 32,193,177 Q260* probably null Het
Lrrfip1 T A 1: 91,115,015 C381S probably benign Het
Mitd1 A T 1: 37,882,697 D85E probably benign Het
Muc4 G A 16: 32,762,518 D2556N possibly damaging Het
Nlrc4 A G 17: 74,445,939 I483T probably damaging Het
Olfr699 A T 7: 106,790,227 M258K probably damaging Het
Olfr70 A G 4: 43,697,170 M1T probably null Het
Olfr967 A G 9: 39,751,244 N286S probably damaging Het
Pcdhb7 C A 18: 37,343,578 A589E probably benign Het
Pcdhgb5 G A 18: 37,731,268 E39K probably damaging Het
Pja2 T C 17: 64,308,959 K314E probably damaging Het
Plcb1 A G 2: 135,262,239 E276G possibly damaging Het
Ppp2r5c A G 12: 110,544,145 E122G probably damaging Het
Prrc2c A T 1: 162,692,844 N732K probably damaging Het
Rb1cc1 T A 1: 6,262,902 D1348E probably benign Het
Sh3rf1 G T 8: 61,361,732 E442* probably null Het
Snapc1 A G 12: 73,970,200 D204G probably damaging Het
Sry C T Y: 2,662,938 D241N unknown Het
Strn4 T A 7: 16,830,354 M303K probably benign Het
Tas2r118 A G 6: 23,969,471 I197T probably benign Het
Tnni3k A G 3: 154,792,776 Y809H probably benign Het
Tnpo3 A T 6: 29,572,595 C419* probably null Het
Trpm6 T C 19: 18,783,163 S143P probably benign Het
Ttc23l A T 15: 10,537,580 C201* probably null Het
Ubr4 A G 4: 139,393,077 N271S probably damaging Het
Vmn2r27 C T 6: 124,224,353 W215* probably null Het
Xirp1 A T 9: 120,017,918 M633K probably damaging Het
Zfp174 T C 16: 3,847,940 I23T possibly damaging Het
Zfp536 T A 7: 37,480,403 S926C probably damaging Het
Zfp943 T C 17: 21,990,941 S65P possibly damaging Het
Other mutations in Vmn1r70
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03092:Vmn1r70 APN 7 10634259 missense probably benign 0.23
IGL03250:Vmn1r70 APN 7 10634281 missense probably damaging 1.00
R0375:Vmn1r70 UTSW 7 10634060 missense probably damaging 1.00
R0482:Vmn1r70 UTSW 7 10634277 missense probably damaging 1.00
R0497:Vmn1r70 UTSW 7 10634026 missense probably benign 0.19
R1964:Vmn1r70 UTSW 7 10633810 missense possibly damaging 0.88
R2067:Vmn1r70 UTSW 7 10634337 missense possibly damaging 0.61
R3807:Vmn1r70 UTSW 7 10633788 missense probably benign 0.01
R4573:Vmn1r70 UTSW 7 10633629 splice site probably null
R5070:Vmn1r70 UTSW 7 10634398 missense probably benign 0.04
R5442:Vmn1r70 UTSW 7 10633950 missense possibly damaging 0.69
R5558:Vmn1r70 UTSW 7 10634475 missense probably benign 0.01
R6036:Vmn1r70 UTSW 7 10633903 missense probably damaging 1.00
R6036:Vmn1r70 UTSW 7 10633903 missense probably damaging 1.00
R6189:Vmn1r70 UTSW 7 10633671 missense probably benign 0.04
R7571:Vmn1r70 UTSW 7 10633944 missense probably benign 0.00
X0020:Vmn1r70 UTSW 7 10633590 missense probably benign
Predicted Primers PCR Primer
(F):5'- CATAGAGTTTGCAGGGGATTTTCC -3'
(R):5'- TGACTTAGTAGCCAAGGATCTGTG -3'

Sequencing Primer
(F):5'- GATTTTCCCTTGGTTGCACATG -3'
(R):5'- CCAAGGATCTGTGAATATACTGGACC -3'
Posted On2018-11-28