Incidental Mutation 'R6976:Olfr699'
ID542460
Institutional Source Beutler Lab
Gene Symbol Olfr699
Ensembl Gene ENSMUSG00000096714
Gene Nameolfactory receptor 699
SynonymsMOR283-10P, GA_x6K02T2PBJ9-9168355-9167405
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R6976 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location106787963-106793198 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 106790227 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 258 (M258K)
Ref Sequence ENSEMBL: ENSMUSP00000149112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065024] [ENSMUST00000215952] [ENSMUST00000216307]
Predicted Effect probably damaging
Transcript: ENSMUST00000065024
AA Change: M258K

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000068023
Gene: ENSMUSG00000096714
AA Change: M258K

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.3e-46 PFAM
Pfam:7TM_GPCR_Srsx 35 303 2.1e-5 PFAM
Pfam:7tm_1 41 290 1.1e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215952
AA Change: M258K

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000216307
AA Change: M258K

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 T A 2: 155,556,009 probably null Het
Adamts4 G T 1: 171,252,308 probably benign Het
Adgrv1 T A 13: 81,520,997 K2480M probably damaging Het
Ankhd1 A C 18: 36,648,254 S2120R probably benign Het
Ash1l T A 3: 88,981,657 V281E possibly damaging Het
Bdh1 G A 16: 31,438,029 A35T probably benign Het
Brpf3 A G 17: 28,835,777 M1098V probably damaging Het
Cel G A 2: 28,556,842 S439F probably damaging Het
Dnah11 T C 12: 118,198,643 S64G probably benign Het
Dpp7 T C 2: 25,354,824 probably null Het
Fam83c T A 2: 155,830,237 Y426F possibly damaging Het
Fasn A G 11: 120,819,867 I322T probably damaging Het
Glod4 A G 11: 76,243,580 F22S probably damaging Het
Gm3127 A G 14: 4,172,441 T231A possibly damaging Het
Gm49383 A G 12: 69,196,956 S444P possibly damaging Het
Gnaz T C 10: 74,991,436 S7P possibly damaging Het
Grin2b C T 6: 135,780,200 S421N probably benign Het
Grm1 T C 10: 10,689,180 D1128G probably benign Het
Hoxb13 A G 11: 96,196,218 T284A probably benign Het
Il9r G A 11: 32,193,177 Q260* probably null Het
Lrrfip1 T A 1: 91,115,015 C381S probably benign Het
Mitd1 A T 1: 37,882,697 D85E probably benign Het
Muc4 G A 16: 32,762,518 D2556N possibly damaging Het
Nlrc4 A G 17: 74,445,939 I483T probably damaging Het
Olfr70 A G 4: 43,697,170 M1T probably null Het
Olfr967 A G 9: 39,751,244 N286S probably damaging Het
Pcdhb7 C A 18: 37,343,578 A589E probably benign Het
Pcdhgb5 G A 18: 37,731,268 E39K probably damaging Het
Pja2 T C 17: 64,308,959 K314E probably damaging Het
Plcb1 A G 2: 135,262,239 E276G possibly damaging Het
Ppp2r5c A G 12: 110,544,145 E122G probably damaging Het
Prrc2c A T 1: 162,692,844 N732K probably damaging Het
Rb1cc1 T A 1: 6,262,902 D1348E probably benign Het
Sh3rf1 G T 8: 61,361,732 E442* probably null Het
Snapc1 A G 12: 73,970,200 D204G probably damaging Het
Sry C T Y: 2,662,938 D241N unknown Het
Strn4 T A 7: 16,830,354 M303K probably benign Het
Tas2r118 A G 6: 23,969,471 I197T probably benign Het
Tnni3k A G 3: 154,792,776 Y809H probably benign Het
Tnpo3 A T 6: 29,572,595 C419* probably null Het
Trpm6 T C 19: 18,783,163 S143P probably benign Het
Ttc23l A T 15: 10,537,580 C201* probably null Het
Ubr4 A G 4: 139,393,077 N271S probably damaging Het
Vmn1r70 T C 7: 10,634,044 M134T probably benign Het
Vmn2r27 C T 6: 124,224,353 W215* probably null Het
Xirp1 A T 9: 120,017,918 M633K probably damaging Het
Zfp174 T C 16: 3,847,940 I23T possibly damaging Het
Zfp536 T A 7: 37,480,403 S926C probably damaging Het
Zfp943 T C 17: 21,990,941 S65P possibly damaging Het
Other mutations in Olfr699
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Olfr699 APN 7 106790589 missense probably benign 0.12
IGL02093:Olfr699 APN 7 106790823 missense probably benign 0.12
IGL02404:Olfr699 APN 7 106790359 missense probably damaging 1.00
IGL03214:Olfr699 APN 7 106790345 missense probably benign
IGL03230:Olfr699 APN 7 106790704 missense probably damaging 1.00
R0194:Olfr699 UTSW 7 106790823 missense probably benign 0.12
R0523:Olfr699 UTSW 7 106790326 missense probably damaging 1.00
R1132:Olfr699 UTSW 7 106790551 missense possibly damaging 0.94
R1373:Olfr699 UTSW 7 106790756 missense probably benign 0.01
R1482:Olfr699 UTSW 7 106790333 missense probably benign 0.00
R1498:Olfr699 UTSW 7 106790416 missense possibly damaging 0.78
R1500:Olfr699 UTSW 7 106790821 missense probably damaging 1.00
R2656:Olfr699 UTSW 7 106790513 missense probably damaging 0.98
R4163:Olfr699 UTSW 7 106790279 missense probably damaging 1.00
R4638:Olfr699 UTSW 7 106790998 start codon destroyed probably null 1.00
R5104:Olfr699 UTSW 7 106790332 missense possibly damaging 0.81
R6216:Olfr699 UTSW 7 106790458 missense probably benign 0.23
R7129:Olfr699 UTSW 7 106790483 missense probably benign 0.00
R7130:Olfr699 UTSW 7 106790182 missense probably benign 0.35
R8104:Olfr699 UTSW 7 106791130 start gained probably benign
R8104:Olfr699 UTSW 7 106791131 start gained probably benign
Z1177:Olfr699 UTSW 7 106790270 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGACTGTGTAGGCAGAAACCAC -3'
(R):5'- ATCCCTCCATTGCTGAAGC -3'

Sequencing Primer
(F):5'- TGTGTAGGCAGAAACCACTTACC -3'
(R):5'- AAGCTGGCTTGTGCAGAC -3'
Posted On2018-11-28