Incidental Mutation 'R6976:Hoxb13'
ID542468
Institutional Source Beutler Lab
Gene Symbol Hoxb13
Ensembl Gene ENSMUSG00000049604
Gene Namehomeobox B13
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6976 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location96194316-96197447 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 96196218 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 284 (T284A)
Ref Sequence ENSEMBL: ENSMUSP00000056315 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062709]
Predicted Effect probably benign
Transcript: ENSMUST00000062709
AA Change: T284A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000056315
Gene: ENSMUSG00000049604
AA Change: T284A

DomainStartEndE-ValueType
Pfam:HoxA13_N 12 124 9.2e-31 PFAM
HOX 218 280 5.62e-21 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that belongs to the homeobox gene family. Genes of this family are highly conserved among vertebrates and essential for vertebrate embryonic development. This gene has been implicated to play a role in fetal skin development and cutaneous regeneration. In mice, a similar gene was shown to exhibit temporal and spatial colinearity in the main body axis of the embryo, but was not expressed in the secondary axes, which suggests functions in body patterning along the axis. This gene and other HOXB genes form a gene cluster at chromosome the 17q21-22 region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for loss of function mutations show overgrowth in all major structures derived from the tail bud. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 T A 2: 155,556,009 probably null Het
Adamts4 G T 1: 171,252,308 probably benign Het
Adgrv1 T A 13: 81,520,997 K2480M probably damaging Het
Ankhd1 A C 18: 36,648,254 S2120R probably benign Het
Ash1l T A 3: 88,981,657 V281E possibly damaging Het
Bdh1 G A 16: 31,438,029 A35T probably benign Het
Brpf3 A G 17: 28,835,777 M1098V probably damaging Het
Cel G A 2: 28,556,842 S439F probably damaging Het
Dnah11 T C 12: 118,198,643 S64G probably benign Het
Dpp7 T C 2: 25,354,824 probably null Het
Fam83c T A 2: 155,830,237 Y426F possibly damaging Het
Fasn A G 11: 120,819,867 I322T probably damaging Het
Glod4 A G 11: 76,243,580 F22S probably damaging Het
Gm3127 A G 14: 4,172,441 T231A possibly damaging Het
Gm49383 A G 12: 69,196,956 S444P possibly damaging Het
Gnaz T C 10: 74,991,436 S7P possibly damaging Het
Grin2b C T 6: 135,780,200 S421N probably benign Het
Grm1 T C 10: 10,689,180 D1128G probably benign Het
Il9r G A 11: 32,193,177 Q260* probably null Het
Lrrfip1 T A 1: 91,115,015 C381S probably benign Het
Mitd1 A T 1: 37,882,697 D85E probably benign Het
Muc4 G A 16: 32,762,518 D2556N possibly damaging Het
Nlrc4 A G 17: 74,445,939 I483T probably damaging Het
Olfr699 A T 7: 106,790,227 M258K probably damaging Het
Olfr70 A G 4: 43,697,170 M1T probably null Het
Olfr967 A G 9: 39,751,244 N286S probably damaging Het
Pcdhb7 C A 18: 37,343,578 A589E probably benign Het
Pcdhgb5 G A 18: 37,731,268 E39K probably damaging Het
Pja2 T C 17: 64,308,959 K314E probably damaging Het
Plcb1 A G 2: 135,262,239 E276G possibly damaging Het
Ppp2r5c A G 12: 110,544,145 E122G probably damaging Het
Prrc2c A T 1: 162,692,844 N732K probably damaging Het
Rb1cc1 T A 1: 6,262,902 D1348E probably benign Het
Sh3rf1 G T 8: 61,361,732 E442* probably null Het
Snapc1 A G 12: 73,970,200 D204G probably damaging Het
Sry C T Y: 2,662,938 D241N unknown Het
Strn4 T A 7: 16,830,354 M303K probably benign Het
Tas2r118 A G 6: 23,969,471 I197T probably benign Het
Tnni3k A G 3: 154,792,776 Y809H probably benign Het
Tnpo3 A T 6: 29,572,595 C419* probably null Het
Trpm6 T C 19: 18,783,163 S143P probably benign Het
Ttc23l A T 15: 10,537,580 C201* probably null Het
Ubr4 A G 4: 139,393,077 N271S probably damaging Het
Vmn1r70 T C 7: 10,634,044 M134T probably benign Het
Vmn2r27 C T 6: 124,224,353 W215* probably null Het
Xirp1 A T 9: 120,017,918 M633K probably damaging Het
Zfp174 T C 16: 3,847,940 I23T possibly damaging Het
Zfp536 T A 7: 37,480,403 S926C probably damaging Het
Zfp943 T C 17: 21,990,941 S65P possibly damaging Het
Other mutations in Hoxb13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Hoxb13 APN 11 96194642 missense possibly damaging 0.79
IGL02005:Hoxb13 APN 11 96194609 missense probably damaging 1.00
IGL02973:Hoxb13 APN 11 96194843 missense probably damaging 1.00
R0943:Hoxb13 UTSW 11 96195973 missense probably benign
R4573:Hoxb13 UTSW 11 96194951 missense probably damaging 1.00
R4658:Hoxb13 UTSW 11 96194483 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- ACGCATTCCCTATAGCAAGG -3'
(R):5'- CACCACGGTCCAGATGAATG -3'

Sequencing Primer
(F):5'- CAAGGGGCAGTTGCGGG -3'
(R):5'- CCACGGTCCAGATGAATGATTATGAC -3'
Posted On2018-11-28