Incidental Mutation 'R6976:Ttc23l'
ID542475
Institutional Source Beutler Lab
Gene Symbol Ttc23l
Ensembl Gene ENSMUSG00000022249
Gene Nametetratricopeptide repeat domain 23-like
Synonyms4930401A09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R6976 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location10500102-10558668 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 10537580 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 201 (C201*)
Ref Sequence ENSEMBL: ENSMUSP00000155921 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022857] [ENSMUST00000167842] [ENSMUST00000167842]
Predicted Effect probably null
Transcript: ENSMUST00000022857
AA Change: C201*
SMART Domains Protein: ENSMUSP00000022857
Gene: ENSMUSG00000022249
AA Change: C201*

DomainStartEndE-ValueType
TPR 159 192 4.21e1 SMART
Blast:TPR 208 239 2e-6 BLAST
TPR 250 283 1.4e1 SMART
low complexity region 292 303 N/A INTRINSIC
TPR 376 409 9.53e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000167842
AA Change: C201*
SMART Domains Protein: ENSMUSP00000127781
Gene: ENSMUSG00000022249
AA Change: C201*

DomainStartEndE-ValueType
low complexity region 18 29 N/A INTRINSIC
Pfam:TPR_1 102 133 3.3e-6 PFAM
low complexity region 148 160 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000167842
AA Change: C201*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 T A 2: 155,556,009 probably null Het
Adamts4 G T 1: 171,252,308 probably benign Het
Adgrv1 T A 13: 81,520,997 K2480M probably damaging Het
Ankhd1 A C 18: 36,648,254 S2120R probably benign Het
Ash1l T A 3: 88,981,657 V281E possibly damaging Het
Bdh1 G A 16: 31,438,029 A35T probably benign Het
Brpf3 A G 17: 28,835,777 M1098V probably damaging Het
Cel G A 2: 28,556,842 S439F probably damaging Het
Dnah11 T C 12: 118,198,643 S64G probably benign Het
Dpp7 T C 2: 25,354,824 probably null Het
Fam83c T A 2: 155,830,237 Y426F possibly damaging Het
Fasn A G 11: 120,819,867 I322T probably damaging Het
Glod4 A G 11: 76,243,580 F22S probably damaging Het
Gm3127 A G 14: 4,172,441 T231A possibly damaging Het
Gm49383 A G 12: 69,196,956 S444P possibly damaging Het
Gnaz T C 10: 74,991,436 S7P possibly damaging Het
Grin2b C T 6: 135,780,200 S421N probably benign Het
Grm1 T C 10: 10,689,180 D1128G probably benign Het
Hoxb13 A G 11: 96,196,218 T284A probably benign Het
Il9r G A 11: 32,193,177 Q260* probably null Het
Lrrfip1 T A 1: 91,115,015 C381S probably benign Het
Mitd1 A T 1: 37,882,697 D85E probably benign Het
Muc4 G A 16: 32,762,518 D2556N possibly damaging Het
Nlrc4 A G 17: 74,445,939 I483T probably damaging Het
Olfr699 A T 7: 106,790,227 M258K probably damaging Het
Olfr70 A G 4: 43,697,170 M1T probably null Het
Olfr967 A G 9: 39,751,244 N286S probably damaging Het
Pcdhb7 C A 18: 37,343,578 A589E probably benign Het
Pcdhgb5 G A 18: 37,731,268 E39K probably damaging Het
Pja2 T C 17: 64,308,959 K314E probably damaging Het
Plcb1 A G 2: 135,262,239 E276G possibly damaging Het
Ppp2r5c A G 12: 110,544,145 E122G probably damaging Het
Prrc2c A T 1: 162,692,844 N732K probably damaging Het
Rb1cc1 T A 1: 6,262,902 D1348E probably benign Het
Sh3rf1 G T 8: 61,361,732 E442* probably null Het
Snapc1 A G 12: 73,970,200 D204G probably damaging Het
Sry C T Y: 2,662,938 D241N unknown Het
Strn4 T A 7: 16,830,354 M303K probably benign Het
Tas2r118 A G 6: 23,969,471 I197T probably benign Het
Tnni3k A G 3: 154,792,776 Y809H probably benign Het
Tnpo3 A T 6: 29,572,595 C419* probably null Het
Trpm6 T C 19: 18,783,163 S143P probably benign Het
Ubr4 A G 4: 139,393,077 N271S probably damaging Het
Vmn1r70 T C 7: 10,634,044 M134T probably benign Het
Vmn2r27 C T 6: 124,224,353 W215* probably null Het
Xirp1 A T 9: 120,017,918 M633K probably damaging Het
Zfp174 T C 16: 3,847,940 I23T possibly damaging Het
Zfp536 T A 7: 37,480,403 S926C probably damaging Het
Zfp943 T C 17: 21,990,941 S65P possibly damaging Het
Other mutations in Ttc23l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Ttc23l APN 15 10530689 missense probably damaging 1.00
IGL01319:Ttc23l APN 15 10509406 splice site probably benign
IGL01562:Ttc23l APN 15 10551390 splice site probably benign
IGL01969:Ttc23l APN 15 10551434 nonsense probably null
IGL03172:Ttc23l APN 15 10537566 missense probably benign 0.06
R0042:Ttc23l UTSW 15 10551541 missense probably damaging 1.00
R0042:Ttc23l UTSW 15 10551541 missense probably damaging 1.00
R0335:Ttc23l UTSW 15 10539963 missense probably benign 0.26
R0554:Ttc23l UTSW 15 10530657 missense probably benign 0.12
R0609:Ttc23l UTSW 15 10504536 missense probably benign
R0631:Ttc23l UTSW 15 10539980 missense probably damaging 1.00
R1703:Ttc23l UTSW 15 10523658 missense probably damaging 1.00
R2106:Ttc23l UTSW 15 10547256 missense probably damaging 1.00
R2220:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R2276:Ttc23l UTSW 15 10523592 missense possibly damaging 0.92
R2277:Ttc23l UTSW 15 10523592 missense possibly damaging 0.92
R2278:Ttc23l UTSW 15 10523592 missense possibly damaging 0.92
R2279:Ttc23l UTSW 15 10523592 missense possibly damaging 0.92
R2368:Ttc23l UTSW 15 10537562 small insertion probably benign
R2368:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R2420:Ttc23l UTSW 15 10537562 small insertion probably benign
R2420:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R2421:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R2422:Ttc23l UTSW 15 10537562 small insertion probably benign
R2422:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R2830:Ttc23l UTSW 15 10537562 small insertion probably benign
R2831:Ttc23l UTSW 15 10537562 small insertion probably benign
R2831:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R2979:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R2980:Ttc23l UTSW 15 10537562 small insertion probably benign
R2980:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R2981:Ttc23l UTSW 15 10537562 small insertion probably benign
R2981:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R2982:Ttc23l UTSW 15 10537562 small insertion probably benign
R2982:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R2983:Ttc23l UTSW 15 10537562 small insertion probably benign
R2983:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R3176:Ttc23l UTSW 15 10547232 missense possibly damaging 0.83
R3177:Ttc23l UTSW 15 10547232 missense possibly damaging 0.83
R3276:Ttc23l UTSW 15 10547232 missense possibly damaging 0.83
R3277:Ttc23l UTSW 15 10547232 missense possibly damaging 0.83
R3722:Ttc23l UTSW 15 10537562 small insertion probably benign
R3722:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R3743:Ttc23l UTSW 15 10537562 small insertion probably benign
R3743:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R3767:Ttc23l UTSW 15 10530695 missense possibly damaging 0.94
R3921:Ttc23l UTSW 15 10537562 small insertion probably benign
R3921:Ttc23l UTSW 15 10537563 small insertion probably benign
R3921:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R4091:Ttc23l UTSW 15 10537562 small insertion probably benign
R4091:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R4119:Ttc23l UTSW 15 10539920 missense probably damaging 1.00
R4120:Ttc23l UTSW 15 10539920 missense probably damaging 1.00
R4373:Ttc23l UTSW 15 10537562 small insertion probably benign
R4373:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R4375:Ttc23l UTSW 15 10537562 small insertion probably benign
R4375:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R4376:Ttc23l UTSW 15 10537562 small insertion probably benign
R4376:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R4377:Ttc23l UTSW 15 10537562 small insertion probably benign
R4377:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R5002:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5106:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5107:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5109:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5156:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5157:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5160:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5161:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5259:Ttc23l UTSW 15 10515150 missense probably damaging 0.99
R5307:Ttc23l UTSW 15 10533659 missense probably damaging 1.00
R5728:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5756:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5772:Ttc23l UTSW 15 10551469 missense probably benign 0.01
R5793:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5794:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5847:Ttc23l UTSW 15 10537596 missense probably benign 0.07
R7010:Ttc23l UTSW 15 10515138 missense probably damaging 1.00
R7342:Ttc23l UTSW 15 10551497 missense probably benign 0.01
R7404:Ttc23l UTSW 15 10551577 missense probably damaging 0.98
R7453:Ttc23l UTSW 15 10533767 missense probably damaging 1.00
R7584:Ttc23l UTSW 15 10533708 missense probably damaging 1.00
R7599:Ttc23l UTSW 15 10533680 missense possibly damaging 0.89
Z1088:Ttc23l UTSW 15 10533667 missense probably damaging 1.00
Z1177:Ttc23l UTSW 15 10533633 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATTAAACGTGGCAGCGTATATAG -3'
(R):5'- CTTGTTTTCCCAAGGGTCGC -3'

Sequencing Primer
(F):5'- GCAGCGTATATAGTAAGCTTGC -3'
(R):5'- CCCAAGGGTCGCTTTTGTTAGC -3'
Posted On2018-11-28