Incidental Mutation 'R6976:Pja2'
ID542481
Institutional Source Beutler Lab
Gene Symbol Pja2
Ensembl Gene ENSMUSG00000024083
Gene Namepraja ring finger ubiquitin ligase 2
SynonymsNeurodap1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6976 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location64281005-64331916 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 64308959 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 314 (K314E)
Ref Sequence ENSEMBL: ENSMUSP00000133730 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024888] [ENSMUST00000024889] [ENSMUST00000172733] [ENSMUST00000172818]
Predicted Effect probably damaging
Transcript: ENSMUST00000024888
AA Change: K314E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000024888
Gene: ENSMUSG00000024083
AA Change: K314E

DomainStartEndE-ValueType
low complexity region 532 548 N/A INTRINSIC
RING 633 673 3.84e-6 SMART
low complexity region 678 703 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000024889
AA Change: K314E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024889
Gene: ENSMUSG00000024083
AA Change: K314E

DomainStartEndE-ValueType
low complexity region 470 486 N/A INTRINSIC
RING 571 611 3.84e-6 SMART
low complexity region 616 641 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172733
AA Change: K314E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133730
Gene: ENSMUSG00000024083
AA Change: K314E

DomainStartEndE-ValueType
low complexity region 470 486 N/A INTRINSIC
RING 571 611 3.84e-6 SMART
low complexity region 616 641 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172818
AA Change: K314E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134380
Gene: ENSMUSG00000024083
AA Change: K314E

DomainStartEndE-ValueType
low complexity region 532 548 N/A INTRINSIC
RING 633 673 3.84e-6 SMART
low complexity region 678 703 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 T A 2: 155,556,009 probably null Het
Adamts4 G T 1: 171,252,308 probably benign Het
Adgrv1 T A 13: 81,520,997 K2480M probably damaging Het
Ankhd1 A C 18: 36,648,254 S2120R probably benign Het
Ash1l T A 3: 88,981,657 V281E possibly damaging Het
Bdh1 G A 16: 31,438,029 A35T probably benign Het
Brpf3 A G 17: 28,835,777 M1098V probably damaging Het
Cel G A 2: 28,556,842 S439F probably damaging Het
Dnah11 T C 12: 118,198,643 S64G probably benign Het
Dpp7 T C 2: 25,354,824 probably null Het
Fam83c T A 2: 155,830,237 Y426F possibly damaging Het
Fasn A G 11: 120,819,867 I322T probably damaging Het
Glod4 A G 11: 76,243,580 F22S probably damaging Het
Gm3127 A G 14: 4,172,441 T231A possibly damaging Het
Gm49383 A G 12: 69,196,956 S444P possibly damaging Het
Gnaz T C 10: 74,991,436 S7P possibly damaging Het
Grin2b C T 6: 135,780,200 S421N probably benign Het
Grm1 T C 10: 10,689,180 D1128G probably benign Het
Hoxb13 A G 11: 96,196,218 T284A probably benign Het
Il9r G A 11: 32,193,177 Q260* probably null Het
Lrrfip1 T A 1: 91,115,015 C381S probably benign Het
Mitd1 A T 1: 37,882,697 D85E probably benign Het
Muc4 G A 16: 32,762,518 D2556N possibly damaging Het
Nlrc4 A G 17: 74,445,939 I483T probably damaging Het
Olfr699 A T 7: 106,790,227 M258K probably damaging Het
Olfr70 A G 4: 43,697,170 M1T probably null Het
Olfr967 A G 9: 39,751,244 N286S probably damaging Het
Pcdhb7 C A 18: 37,343,578 A589E probably benign Het
Pcdhgb5 G A 18: 37,731,268 E39K probably damaging Het
Plcb1 A G 2: 135,262,239 E276G possibly damaging Het
Ppp2r5c A G 12: 110,544,145 E122G probably damaging Het
Prrc2c A T 1: 162,692,844 N732K probably damaging Het
Rb1cc1 T A 1: 6,262,902 D1348E probably benign Het
Sh3rf1 G T 8: 61,361,732 E442* probably null Het
Snapc1 A G 12: 73,970,200 D204G probably damaging Het
Sry C T Y: 2,662,938 D241N unknown Het
Strn4 T A 7: 16,830,354 M303K probably benign Het
Tas2r118 A G 6: 23,969,471 I197T probably benign Het
Tnni3k A G 3: 154,792,776 Y809H probably benign Het
Tnpo3 A T 6: 29,572,595 C419* probably null Het
Trpm6 T C 19: 18,783,163 S143P probably benign Het
Ttc23l A T 15: 10,537,580 C201* probably null Het
Ubr4 A G 4: 139,393,077 N271S probably damaging Het
Vmn1r70 T C 7: 10,634,044 M134T probably benign Het
Vmn2r27 C T 6: 124,224,353 W215* probably null Het
Xirp1 A T 9: 120,017,918 M633K probably damaging Het
Zfp174 T C 16: 3,847,940 I23T possibly damaging Het
Zfp536 T A 7: 37,480,403 S926C probably damaging Het
Zfp943 T C 17: 21,990,941 S65P possibly damaging Het
Other mutations in Pja2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Pja2 APN 17 64283531 missense probably damaging 1.00
IGL00945:Pja2 APN 17 64309396 missense probably benign 0.00
IGL01347:Pja2 APN 17 64313028 missense probably benign 0.34
IGL01831:Pja2 APN 17 64309407 missense probably benign 0.02
IGL01977:Pja2 APN 17 64297826 missense probably benign 0.02
IGL02812:Pja2 APN 17 64297794 missense probably damaging 1.00
H8441:Pja2 UTSW 17 64311197 missense probably damaging 1.00
R0062:Pja2 UTSW 17 64308971 missense probably damaging 1.00
R0062:Pja2 UTSW 17 64308971 missense probably damaging 1.00
R0411:Pja2 UTSW 17 64287521 splice site probably benign
R1240:Pja2 UTSW 17 64309618 missense probably benign 0.00
R1528:Pja2 UTSW 17 64309222 missense possibly damaging 0.75
R1996:Pja2 UTSW 17 64287644 critical splice acceptor site probably null
R2111:Pja2 UTSW 17 64290036 missense probably damaging 1.00
R2162:Pja2 UTSW 17 64309402 missense probably benign 0.00
R2201:Pja2 UTSW 17 64311167 splice site probably benign
R2276:Pja2 UTSW 17 64292870 missense probably damaging 1.00
R2278:Pja2 UTSW 17 64292870 missense probably damaging 1.00
R3831:Pja2 UTSW 17 64309402 missense probably benign 0.00
R3833:Pja2 UTSW 17 64309402 missense probably benign 0.00
R4598:Pja2 UTSW 17 64313030 start codon destroyed probably null 0.69
R4801:Pja2 UTSW 17 64292862 missense probably damaging 1.00
R4802:Pja2 UTSW 17 64292862 missense probably damaging 1.00
R4983:Pja2 UTSW 17 64309058 missense probably benign 0.00
R5634:Pja2 UTSW 17 64292867 missense probably damaging 1.00
R5862:Pja2 UTSW 17 64297826 missense probably benign 0.02
R5905:Pja2 UTSW 17 64309090 missense probably benign 0.26
R6028:Pja2 UTSW 17 64309090 missense probably benign 0.26
R6382:Pja2 UTSW 17 64309615 missense probably benign 0.07
R6650:Pja2 UTSW 17 64292941 missense probably damaging 1.00
R6725:Pja2 UTSW 17 64289967 missense probably damaging 1.00
R7250:Pja2 UTSW 17 64309456 missense probably benign 0.01
R7389:Pja2 UTSW 17 64297727 missense probably damaging 1.00
R7477:Pja2 UTSW 17 64309645 missense possibly damaging 0.87
R7549:Pja2 UTSW 17 64309415 missense probably damaging 0.98
Z1176:Pja2 UTSW 17 64292869 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGGAACATGCAGTCGTGGTC -3'
(R):5'- TTCTACTGCCGATGCTGAGC -3'

Sequencing Primer
(F):5'- AGTCGTGGTCTCCATCATAATCG -3'
(R):5'- ATGCTGAGCTTGTCCATCAGAATG -3'
Posted On2018-11-28