Incidental Mutation 'R6977:Cyp2b23'
ID542505
Institutional Source Beutler Lab
Gene Symbol Cyp2b23
Ensembl Gene ENSMUSG00000040650
Gene Namecytochrome P450, family 2, subfamily b, polypeptide 23
SynonymsEG243881
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R6977 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location26665227-26686437 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 26681320 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 160 (Y160C)
Ref Sequence ENSEMBL: ENSMUSP00000076578 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077356]
Predicted Effect possibly damaging
Transcript: ENSMUST00000077356
AA Change: Y160C

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000076578
Gene: ENSMUSG00000040650
AA Change: Y160C

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:p450 31 488 2.9e-148 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik G A 13: 59,691,580 S17L possibly damaging Het
Acap2 G T 16: 31,117,261 T336K probably damaging Het
Angptl7 A T 4: 148,497,393 W179R probably damaging Het
Atp9b A G 18: 80,753,102 F909L probably damaging Het
BC048403 A G 10: 121,745,466 H124R probably damaging Het
BC051665 A T 13: 60,784,672 Y66* probably null Het
C8b A G 4: 104,786,996 T287A possibly damaging Het
Camk2a G A 18: 60,960,004 G301E probably damaging Het
Ccdc186 A G 19: 56,798,787 M583T probably benign Het
Cd55b T A 1: 130,419,791 K94N probably damaging Het
Celsr3 T C 9: 108,827,715 S466P probably benign Het
Cep152 A G 2: 125,568,822 probably null Het
Cep70 A G 9: 99,291,676 D420G probably damaging Het
Cnih4 T C 1: 181,162,148 S48P possibly damaging Het
Cpne8 T C 15: 90,497,091 K507E probably benign Het
Dnah9 C A 11: 66,107,909 M1104I probably benign Het
Fam135a T A 1: 24,054,098 N149I probably damaging Het
Fbxl4 A T 4: 22,376,930 Q122L probably benign Het
Gm11232 T C 4: 71,757,941 probably benign Het
Gm5901 A G 7: 105,377,160 Y45C probably benign Het
Gsap A T 5: 21,271,221 I553F probably damaging Het
Ifih1 A G 2: 62,606,186 F631S probably damaging Het
Kif21a T C 15: 90,980,837 D544G probably damaging Het
Klc2 G A 19: 5,109,365 R552C probably damaging Het
Lamp1 T C 8: 13,173,661 V293A probably damaging Het
Muc16 T A 9: 18,645,337 D3220V unknown Het
Myb A T 10: 21,152,652 I104K probably damaging Het
Mycbp2 C A 14: 103,154,906 R3227L probably damaging Het
Ncapd2 A T 6: 125,171,509 L1053Q probably damaging Het
Nelfe T A 17: 34,854,712 V316E probably damaging Het
Noxred1 T C 12: 87,221,317 I347V probably null Het
Olfr150 A G 9: 39,737,034 Y73C probably benign Het
Plekha7 A G 7: 116,135,967 V1033A probably benign Het
Plekhh1 G C 12: 79,065,717 W589C probably damaging Het
Ppp6r3 A T 19: 3,467,272 F658L probably damaging Het
Prss55 A G 14: 64,079,336 M119T probably damaging Het
Rab28 G A 5: 41,698,392 Q87* probably null Het
Rsf1 GGCG GGCGACGGCAGCG 7: 97,579,906 probably benign Het
Sdr16c6 A T 4: 4,076,865 F11L probably benign Het
Serpinb5 T G 1: 106,872,347 V89G probably benign Het
Slc12a9 A T 5: 137,315,813 V628E probably damaging Het
Slc25a34 G A 4: 141,620,498 R291C probably damaging Het
Slmap C T 14: 26,533,419 R36H probably damaging Het
Sybu A G 15: 44,677,695 S324P probably benign Het
Syk A T 13: 52,633,058 M363L probably benign Het
Tecpr2 T C 12: 110,939,766 V934A probably benign Het
Thpo A G 16: 20,725,683 L200P probably damaging Het
Tiam2 T A 17: 3,518,659 S1693R probably damaging Het
Usp48 A G 4: 137,650,360 D232G probably damaging Het
Wasf1 A G 10: 40,926,585 S79G probably damaging Het
Zfp90 G T 8: 106,425,316 D554Y probably damaging Het
Zfp90 A T 8: 106,425,317 D554V probably damaging Het
Zic5 T C 14: 122,459,548 T552A unknown Het
Zic5 CGACGAGTAG C 14: 122,459,555 probably benign Het
Other mutations in Cyp2b23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01716:Cyp2b23 APN 7 26679490 missense probably damaging 0.98
IGL01879:Cyp2b23 APN 7 26672854 missense probably benign 0.04
IGL02207:Cyp2b23 APN 7 26681755 missense probably damaging 1.00
IGL03047:Cyp2b23 APN 7 26681467 splice site probably benign
R0117:Cyp2b23 UTSW 7 26673114 missense probably benign 0.25
R0265:Cyp2b23 UTSW 7 26672879 splice site probably benign
R1457:Cyp2b23 UTSW 7 26673149 missense probably damaging 1.00
R1605:Cyp2b23 UTSW 7 26686418 missense probably benign 0.02
R1639:Cyp2b23 UTSW 7 26686417 missense possibly damaging 0.77
R1741:Cyp2b23 UTSW 7 26673077 missense possibly damaging 0.94
R2042:Cyp2b23 UTSW 7 26666108 missense probably damaging 1.00
R3911:Cyp2b23 UTSW 7 26681417 missense probably benign 0.02
R4078:Cyp2b23 UTSW 7 26673092 missense probably damaging 1.00
R4279:Cyp2b23 UTSW 7 26666027 missense possibly damaging 0.89
R4668:Cyp2b23 UTSW 7 26672734 missense probably damaging 1.00
R5419:Cyp2b23 UTSW 7 26681423 nonsense probably null
R5516:Cyp2b23 UTSW 7 26673057 nonsense probably null
R5723:Cyp2b23 UTSW 7 26681396 missense probably benign 0.41
R5873:Cyp2b23 UTSW 7 26675006 missense probably benign 0.02
R6346:Cyp2b23 UTSW 7 26681725 missense probably damaging 0.98
R7131:Cyp2b23 UTSW 7 26681413 missense probably benign 0.25
R7181:Cyp2b23 UTSW 7 26674403 missense probably damaging 1.00
R7715:Cyp2b23 UTSW 7 26681695 missense probably benign
R7877:Cyp2b23 UTSW 7 26686426 missense probably damaging 0.97
R7880:Cyp2b23 UTSW 7 26673134 missense probably damaging 1.00
R8004:Cyp2b23 UTSW 7 26679466 missense probably benign
R8072:Cyp2b23 UTSW 7 26666006 missense probably damaging 1.00
R8083:Cyp2b23 UTSW 7 26686403 missense possibly damaging 0.62
Z1088:Cyp2b23 UTSW 7 26681411 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GAAGTGACCACCATTTTCAGAAC -3'
(R):5'- TATCTGAGTTCTGGGGAAGGCC -3'

Sequencing Primer
(F):5'- GACCACCATTTTCAGAACATGTTTTG -3'
(R):5'- GGGATTCCAGTGTGACCTAAC -3'
Posted On2018-11-28