Incidental Mutation 'R6977:Muc16'
ID542512
Institutional Source Beutler Lab
Gene Symbol Muc16
Ensembl Gene ENSMUSG00000109564
Gene Namemucin 16
Synonyms1110008I14Rik, LOC385009
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.200) question?
Stock #R6977 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location18495455-18674530 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 18645337 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 3220 (D3220V)
Ref Sequence ENSEMBL: ENSMUSP00000147104 (fasta)
Predicted Effect unknown
Transcript: ENSMUST00000208663
AA Change: D3220V
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice are viable and fertile with no gross histological abnormalities. Homozygous male mice father larger litters when crossed to wild-type females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik G A 13: 59,691,580 S17L possibly damaging Het
Acap2 G T 16: 31,117,261 T336K probably damaging Het
Angptl7 A T 4: 148,497,393 W179R probably damaging Het
Atp9b A G 18: 80,753,102 F909L probably damaging Het
BC048403 A G 10: 121,745,466 H124R probably damaging Het
BC051665 A T 13: 60,784,672 Y66* probably null Het
C8b A G 4: 104,786,996 T287A possibly damaging Het
Camk2a G A 18: 60,960,004 G301E probably damaging Het
Ccdc186 A G 19: 56,798,787 M583T probably benign Het
Cd55b T A 1: 130,419,791 K94N probably damaging Het
Celsr3 T C 9: 108,827,715 S466P probably benign Het
Cep152 A G 2: 125,568,822 probably null Het
Cep70 A G 9: 99,291,676 D420G probably damaging Het
Cnih4 T C 1: 181,162,148 S48P possibly damaging Het
Cpne8 T C 15: 90,497,091 K507E probably benign Het
Cyp2b23 T C 7: 26,681,320 Y160C possibly damaging Het
Dnah9 C A 11: 66,107,909 M1104I probably benign Het
Fam135a T A 1: 24,054,098 N149I probably damaging Het
Fbxl4 A T 4: 22,376,930 Q122L probably benign Het
Gm11232 T C 4: 71,757,941 probably benign Het
Gm5901 A G 7: 105,377,160 Y45C probably benign Het
Gsap A T 5: 21,271,221 I553F probably damaging Het
Ifih1 A G 2: 62,606,186 F631S probably damaging Het
Kif21a T C 15: 90,980,837 D544G probably damaging Het
Klc2 G A 19: 5,109,365 R552C probably damaging Het
Lamp1 T C 8: 13,173,661 V293A probably damaging Het
Myb A T 10: 21,152,652 I104K probably damaging Het
Mycbp2 C A 14: 103,154,906 R3227L probably damaging Het
Ncapd2 A T 6: 125,171,509 L1053Q probably damaging Het
Nelfe T A 17: 34,854,712 V316E probably damaging Het
Noxred1 T C 12: 87,221,317 I347V probably null Het
Olfr150 A G 9: 39,737,034 Y73C probably benign Het
Plekha7 A G 7: 116,135,967 V1033A probably benign Het
Plekhh1 G C 12: 79,065,717 W589C probably damaging Het
Ppp6r3 A T 19: 3,467,272 F658L probably damaging Het
Prss55 A G 14: 64,079,336 M119T probably damaging Het
Rab28 G A 5: 41,698,392 Q87* probably null Het
Rsf1 GGCG GGCGACGGCAGCG 7: 97,579,906 probably benign Het
Sdr16c6 A T 4: 4,076,865 F11L probably benign Het
Serpinb5 T G 1: 106,872,347 V89G probably benign Het
Slc12a9 A T 5: 137,315,813 V628E probably damaging Het
Slc25a34 G A 4: 141,620,498 R291C probably damaging Het
Slmap C T 14: 26,533,419 R36H probably damaging Het
Sybu A G 15: 44,677,695 S324P probably benign Het
Syk A T 13: 52,633,058 M363L probably benign Het
Tecpr2 T C 12: 110,939,766 V934A probably benign Het
Thpo A G 16: 20,725,683 L200P probably damaging Het
Tiam2 T A 17: 3,518,659 S1693R probably damaging Het
Usp48 A G 4: 137,650,360 D232G probably damaging Het
Wasf1 A G 10: 40,926,585 S79G probably damaging Het
Zfp90 G T 8: 106,425,316 D554Y probably damaging Het
Zfp90 A T 8: 106,425,317 D554V probably damaging Het
Zic5 T C 14: 122,459,548 T552A unknown Het
Zic5 CGACGAGTAG C 14: 122,459,555 probably benign Het
Other mutations in Muc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:Muc16 APN 9 18508507 missense possibly damaging 0.89
IGL01878:Muc16 APN 9 18495543 missense possibly damaging 0.90
IGL02394:Muc16 APN 9 18498700 missense probably damaging 0.99
IGL02553:Muc16 APN 9 18498553 critical splice donor site probably null
R0400:Muc16 UTSW 9 18510534 missense possibly damaging 0.74
R1620:Muc16 UTSW 9 18510477 missense possibly damaging 0.89
R1695:Muc16 UTSW 9 18497433 missense probably damaging 1.00
R3196:Muc16 UTSW 9 18497830 missense probably damaging 1.00
R5982:Muc16 UTSW 9 18647146 missense unknown
R5990:Muc16 UTSW 9 18659243 missense unknown
R6024:Muc16 UTSW 9 18646671 missense unknown
R6026:Muc16 UTSW 9 18659858 missense unknown
R6028:Muc16 UTSW 9 18657176 missense unknown
R6083:Muc16 UTSW 9 18657212 missense unknown
R6089:Muc16 UTSW 9 18643252 missense unknown
R6109:Muc16 UTSW 9 18655359 missense unknown
R6127:Muc16 UTSW 9 18657878 missense unknown
R6130:Muc16 UTSW 9 18590698 missense probably damaging 1.00
R6146:Muc16 UTSW 9 18497797 missense probably damaging 0.98
R6161:Muc16 UTSW 9 18647818 missense unknown
R6164:Muc16 UTSW 9 18558379 missense probably damaging 1.00
R6185:Muc16 UTSW 9 18654473 missense unknown
R6192:Muc16 UTSW 9 18658689 missense unknown
R6217:Muc16 UTSW 9 18655446 missense unknown
R6232:Muc16 UTSW 9 18656998 missense unknown
R6246:Muc16 UTSW 9 18577067 intron probably null
R6255:Muc16 UTSW 9 18655599 missense unknown
R6280:Muc16 UTSW 9 18579317 critical splice donor site probably null
R6286:Muc16 UTSW 9 18644389 missense unknown
R6287:Muc16 UTSW 9 18659034 missense unknown
R6307:Muc16 UTSW 9 18647588 missense unknown
R6310:Muc16 UTSW 9 18641950 missense probably benign 0.00
R6316:Muc16 UTSW 9 18641819 missense probably benign 0.01
R6335:Muc16 UTSW 9 18660708 missense unknown
R6345:Muc16 UTSW 9 18654926 missense unknown
R6349:Muc16 UTSW 9 18657329 missense unknown
R6366:Muc16 UTSW 9 18646044 missense unknown
R6393:Muc16 UTSW 9 18647399 nonsense probably null
R6440:Muc16 UTSW 9 18641359 missense probably benign 0.01
R6458:Muc16 UTSW 9 18641721 missense probably benign 0.01
R6460:Muc16 UTSW 9 18640516 missense probably benign 0.01
R6481:Muc16 UTSW 9 18550677 critical splice donor site probably null
R6539:Muc16 UTSW 9 18637325 missense probably benign 0.25
R6551:Muc16 UTSW 9 18562562 missense possibly damaging 0.95
R6596:Muc16 UTSW 9 18566715 missense probably benign 0.18
R6601:Muc16 UTSW 9 18637570 missense probably benign 0.10
R6602:Muc16 UTSW 9 18609476 intron probably null
R6615:Muc16 UTSW 9 18647188 missense unknown
R6625:Muc16 UTSW 9 18660278 missense unknown
R6668:Muc16 UTSW 9 18640385 missense probably benign 0.03
R6697:Muc16 UTSW 9 18641291 missense probably benign 0.01
R6710:Muc16 UTSW 9 18642070 missense possibly damaging 0.95
R6727:Muc16 UTSW 9 18566690 critical splice donor site probably null
R6789:Muc16 UTSW 9 18559986 missense probably benign 0.40
R6806:Muc16 UTSW 9 18537910 critical splice donor site probably null
R6874:Muc16 UTSW 9 18658769 nonsense probably null
R6894:Muc16 UTSW 9 18495576 missense possibly damaging 0.92
R6913:Muc16 UTSW 9 18642663 missense unknown
R6919:Muc16 UTSW 9 18660299 missense unknown
R6939:Muc16 UTSW 9 18638537 missense probably benign 0.04
R6953:Muc16 UTSW 9 18640529 missense probably benign 0.01
R6956:Muc16 UTSW 9 18645026 missense unknown
R6996:Muc16 UTSW 9 18645897 missense unknown
R7011:Muc16 UTSW 9 18637451 missense probably benign 0.26
R7011:Muc16 UTSW 9 18637543 missense probably benign 0.10
R7012:Muc16 UTSW 9 18495618 critical splice acceptor site probably null
R7014:Muc16 UTSW 9 18658236 missense unknown
R7021:Muc16 UTSW 9 18554919 missense unknown
R7021:Muc16 UTSW 9 18550831 splice site probably null
R7038:Muc16 UTSW 9 18620468 missense probably damaging 0.99
R7057:Muc16 UTSW 9 18646079 missense unknown
R7058:Muc16 UTSW 9 18639755 missense probably benign 0.10
R7066:Muc16 UTSW 9 18658021 missense unknown
R7067:Muc16 UTSW 9 18658251 missense unknown
R7070:Muc16 UTSW 9 18645923 nonsense probably null
R7074:Muc16 UTSW 9 18655650 missense unknown
R7085:Muc16 UTSW 9 18644849 missense unknown
R7088:Muc16 UTSW 9 18592680 missense probably damaging 0.99
R7107:Muc16 UTSW 9 18637298 missense probably benign 0.10
R7108:Muc16 UTSW 9 18655233 missense unknown
R7126:Muc16 UTSW 9 18641216 missense probably benign 0.01
R7128:Muc16 UTSW 9 18643004 missense unknown
R7145:Muc16 UTSW 9 18655580 missense unknown
R7179:Muc16 UTSW 9 18642008 missense probably benign 0.00
R7194:Muc16 UTSW 9 18674454 missense unknown
R7211:Muc16 UTSW 9 18498570 missense probably damaging 1.00
R7213:Muc16 UTSW 9 18641416 missense probably benign 0.01
R7217:Muc16 UTSW 9 18644076 nonsense probably null
R7221:Muc16 UTSW 9 18642199 missense probably benign 0.04
R7265:Muc16 UTSW 9 18656472 missense unknown
R7326:Muc16 UTSW 9 18585013 missense probably benign 0.03
R7359:Muc16 UTSW 9 18643020 missense unknown
R7387:Muc16 UTSW 9 18641720 missense probably benign 0.01
R7391:Muc16 UTSW 9 18639536 missense probably benign 0.04
R7398:Muc16 UTSW 9 18637742 missense possibly damaging 0.46
R7419:Muc16 UTSW 9 18641962 missense probably benign 0.01
R7431:Muc16 UTSW 9 18607993 missense
R7484:Muc16 UTSW 9 18646768 missense unknown
R7487:Muc16 UTSW 9 18584799 missense possibly damaging 0.93
R7497:Muc16 UTSW 9 18645089 missense unknown
R7515:Muc16 UTSW 9 18639662 missense probably benign 0.00
R7537:Muc16 UTSW 9 18638135 missense probably benign 0.06
R7538:Muc16 UTSW 9 18642131 missense probably benign 0.10
R7538:Muc16 UTSW 9 18655451 missense unknown
R7543:Muc16 UTSW 9 18644732 missense unknown
R7566:Muc16 UTSW 9 18638629 missense probably benign 0.00
R7581:Muc16 UTSW 9 18645614 missense unknown
R7594:Muc16 UTSW 9 18645062 missense unknown
R7629:Muc16 UTSW 9 18566785 missense possibly damaging 0.86
R7664:Muc16 UTSW 9 18607722 missense probably benign 0.08
R7666:Muc16 UTSW 9 18558427 missense probably damaging 1.00
R7703:Muc16 UTSW 9 18605282 missense
R7727:Muc16 UTSW 9 18660242 missense unknown
Predicted Primers PCR Primer
(F):5'- GGTGATGTCATAATTTCTGGAACAC -3'
(R):5'- CAATTGGAGACCACAGCCTC -3'

Sequencing Primer
(F):5'- TCTGGAACACTAGTTGAAATGGTG -3'
(R):5'- GAGACCACAGCCTCAGGAG -3'
Posted On2018-11-28