Incidental Mutation 'R6977:Olfr150'
ID542513
Institutional Source Beutler Lab
Gene Symbol Olfr150
Ensembl Gene ENSMUSG00000094353
Gene Nameolfactory receptor 150
SynonymsGA_x6K02T2PVTD-33434302-33435240, MOR171-18, M93
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R6977 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location39730978-39738456 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 39737034 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 73 (Y73C)
Ref Sequence ENSEMBL: ENSMUSP00000150024 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078557] [ENSMUST00000217257]
Predicted Effect probably benign
Transcript: ENSMUST00000078557
AA Change: Y73C

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000077635
Gene: ENSMUSG00000094353
AA Change: Y73C

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.7e-50 PFAM
Pfam:7tm_1 41 290 1.3e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217257
AA Change: Y73C

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik G A 13: 59,691,580 S17L possibly damaging Het
Acap2 G T 16: 31,117,261 T336K probably damaging Het
Angptl7 A T 4: 148,497,393 W179R probably damaging Het
Atp9b A G 18: 80,753,102 F909L probably damaging Het
BC048403 A G 10: 121,745,466 H124R probably damaging Het
BC051665 A T 13: 60,784,672 Y66* probably null Het
C8b A G 4: 104,786,996 T287A possibly damaging Het
Camk2a G A 18: 60,960,004 G301E probably damaging Het
Ccdc186 A G 19: 56,798,787 M583T probably benign Het
Cd55b T A 1: 130,419,791 K94N probably damaging Het
Celsr3 T C 9: 108,827,715 S466P probably benign Het
Cep152 A G 2: 125,568,822 probably null Het
Cep70 A G 9: 99,291,676 D420G probably damaging Het
Cnih4 T C 1: 181,162,148 S48P possibly damaging Het
Cpne8 T C 15: 90,497,091 K507E probably benign Het
Cyp2b23 T C 7: 26,681,320 Y160C possibly damaging Het
Dnah9 C A 11: 66,107,909 M1104I probably benign Het
Fam135a T A 1: 24,054,098 N149I probably damaging Het
Fbxl4 A T 4: 22,376,930 Q122L probably benign Het
Gm11232 T C 4: 71,757,941 probably benign Het
Gm5901 A G 7: 105,377,160 Y45C probably benign Het
Gsap A T 5: 21,271,221 I553F probably damaging Het
Ifih1 A G 2: 62,606,186 F631S probably damaging Het
Kif21a T C 15: 90,980,837 D544G probably damaging Het
Klc2 G A 19: 5,109,365 R552C probably damaging Het
Lamp1 T C 8: 13,173,661 V293A probably damaging Het
Muc16 T A 9: 18,645,337 D3220V unknown Het
Myb A T 10: 21,152,652 I104K probably damaging Het
Mycbp2 C A 14: 103,154,906 R3227L probably damaging Het
Ncapd2 A T 6: 125,171,509 L1053Q probably damaging Het
Nelfe T A 17: 34,854,712 V316E probably damaging Het
Noxred1 T C 12: 87,221,317 I347V probably null Het
Plekha7 A G 7: 116,135,967 V1033A probably benign Het
Plekhh1 G C 12: 79,065,717 W589C probably damaging Het
Ppp6r3 A T 19: 3,467,272 F658L probably damaging Het
Prss55 A G 14: 64,079,336 M119T probably damaging Het
Rab28 G A 5: 41,698,392 Q87* probably null Het
Rsf1 GGCG GGCGACGGCAGCG 7: 97,579,906 probably benign Het
Sdr16c6 A T 4: 4,076,865 F11L probably benign Het
Serpinb5 T G 1: 106,872,347 V89G probably benign Het
Slc12a9 A T 5: 137,315,813 V628E probably damaging Het
Slc25a34 G A 4: 141,620,498 R291C probably damaging Het
Slmap C T 14: 26,533,419 R36H probably damaging Het
Sybu A G 15: 44,677,695 S324P probably benign Het
Syk A T 13: 52,633,058 M363L probably benign Het
Tecpr2 T C 12: 110,939,766 V934A probably benign Het
Thpo A G 16: 20,725,683 L200P probably damaging Het
Tiam2 T A 17: 3,518,659 S1693R probably damaging Het
Usp48 A G 4: 137,650,360 D232G probably damaging Het
Wasf1 A G 10: 40,926,585 S79G probably damaging Het
Zfp90 G T 8: 106,425,316 D554Y probably damaging Het
Zfp90 A T 8: 106,425,317 D554V probably damaging Het
Zic5 T C 14: 122,459,548 T552A unknown Het
Zic5 CGACGAGTAG C 14: 122,459,555 probably benign Het
Other mutations in Olfr150
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Olfr150 APN 9 39737499 missense probably damaging 1.00
IGL01110:Olfr150 APN 9 39737397 missense probably benign 0.00
IGL01343:Olfr150 APN 9 39737715 missense probably damaging 0.99
IGL01942:Olfr150 APN 9 39737666 missense possibly damaging 0.90
IGL02044:Olfr150 APN 9 39736974 missense possibly damaging 0.94
PIT4486001:Olfr150 UTSW 9 39737239 nonsense probably null
R1178:Olfr150 UTSW 9 39737346 missense probably damaging 1.00
R1451:Olfr150 UTSW 9 39737316 missense probably benign 0.00
R1672:Olfr150 UTSW 9 39737196 missense probably damaging 1.00
R1916:Olfr150 UTSW 9 39737622 missense probably benign 0.06
R2095:Olfr150 UTSW 9 39737261 missense probably damaging 0.98
R2116:Olfr150 UTSW 9 39737304 missense probably damaging 0.98
R4183:Olfr150 UTSW 9 39737048 missense probably benign 0.01
R4259:Olfr150 UTSW 9 39737703 missense probably damaging 1.00
R4590:Olfr150 UTSW 9 39736850 missense probably damaging 1.00
R5188:Olfr150 UTSW 9 39737235 missense probably benign 0.00
R6158:Olfr150 UTSW 9 39737076 missense probably benign
R6361:Olfr150 UTSW 9 39737672 missense probably damaging 1.00
R6807:Olfr150 UTSW 9 39737618 nonsense probably null
R7412:Olfr150 UTSW 9 39737126 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- TGACTGAGTTCATCATCTCTGGG -3'
(R):5'- TACCATCCAGGAACAGACTTGG -3'

Sequencing Primer
(F):5'- ACTGAGTTCATCATCTCTGGGTTAAC -3'
(R):5'- CATCCAGGAACAGACTTGGTAAGAC -3'
Posted On2018-11-28