Incidental Mutation 'R6977:Prss55'
ID542527
Institutional Source Beutler Lab
Gene Symbol Prss55
Ensembl Gene ENSMUSG00000034623
Gene Nameprotease, serine 55
Synonyms4933401F05Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R6977 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location64075438-64090162 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 64079336 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 119 (M119T)
Ref Sequence ENSEMBL: ENSMUSP00000128485 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089338] [ENSMUST00000171503]
Predicted Effect probably damaging
Transcript: ENSMUST00000089338
AA Change: M119T

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000086752
Gene: ENSMUSG00000034623
AA Change: M119T

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Tryp_SPc 34 261 1.55e-80 SMART
low complexity region 277 294 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171503
AA Change: M119T

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000128485
Gene: ENSMUSG00000034623
AA Change: M119T

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Tryp_SPc 34 225 1.77e-43 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a group of membrane-anchored chymotrypsin (S1)-like serine proteases. The enocoded protein is primarily expressed in the Leydig and Sertoli cells of the testis and may be involved in male fertility. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik G A 13: 59,691,580 S17L possibly damaging Het
Acap2 G T 16: 31,117,261 T336K probably damaging Het
Angptl7 A T 4: 148,497,393 W179R probably damaging Het
Atp9b A G 18: 80,753,102 F909L probably damaging Het
BC048403 A G 10: 121,745,466 H124R probably damaging Het
BC051665 A T 13: 60,784,672 Y66* probably null Het
C8b A G 4: 104,786,996 T287A possibly damaging Het
Camk2a G A 18: 60,960,004 G301E probably damaging Het
Ccdc186 A G 19: 56,798,787 M583T probably benign Het
Cd55b T A 1: 130,419,791 K94N probably damaging Het
Celsr3 T C 9: 108,827,715 S466P probably benign Het
Cep152 A G 2: 125,568,822 probably null Het
Cep70 A G 9: 99,291,676 D420G probably damaging Het
Cnih4 T C 1: 181,162,148 S48P possibly damaging Het
Cpne8 T C 15: 90,497,091 K507E probably benign Het
Cyp2b23 T C 7: 26,681,320 Y160C possibly damaging Het
Dnah9 C A 11: 66,107,909 M1104I probably benign Het
Fam135a T A 1: 24,054,098 N149I probably damaging Het
Fbxl4 A T 4: 22,376,930 Q122L probably benign Het
Gm11232 T C 4: 71,757,941 probably benign Het
Gm5901 A G 7: 105,377,160 Y45C probably benign Het
Gsap A T 5: 21,271,221 I553F probably damaging Het
Ifih1 A G 2: 62,606,186 F631S probably damaging Het
Kif21a T C 15: 90,980,837 D544G probably damaging Het
Klc2 G A 19: 5,109,365 R552C probably damaging Het
Lamp1 T C 8: 13,173,661 V293A probably damaging Het
Muc16 T A 9: 18,645,337 D3220V unknown Het
Myb A T 10: 21,152,652 I104K probably damaging Het
Mycbp2 C A 14: 103,154,906 R3227L probably damaging Het
Ncapd2 A T 6: 125,171,509 L1053Q probably damaging Het
Nelfe T A 17: 34,854,712 V316E probably damaging Het
Noxred1 T C 12: 87,221,317 I347V probably null Het
Olfr150 A G 9: 39,737,034 Y73C probably benign Het
Plekha7 A G 7: 116,135,967 V1033A probably benign Het
Plekhh1 G C 12: 79,065,717 W589C probably damaging Het
Ppp6r3 A T 19: 3,467,272 F658L probably damaging Het
Rab28 G A 5: 41,698,392 Q87* probably null Het
Rsf1 GGCG GGCGACGGCAGCG 7: 97,579,906 probably benign Het
Sdr16c6 A T 4: 4,076,865 F11L probably benign Het
Serpinb5 T G 1: 106,872,347 V89G probably benign Het
Slc12a9 A T 5: 137,315,813 V628E probably damaging Het
Slc25a34 G A 4: 141,620,498 R291C probably damaging Het
Slmap C T 14: 26,533,419 R36H probably damaging Het
Sybu A G 15: 44,677,695 S324P probably benign Het
Syk A T 13: 52,633,058 M363L probably benign Het
Tecpr2 T C 12: 110,939,766 V934A probably benign Het
Thpo A G 16: 20,725,683 L200P probably damaging Het
Tiam2 T A 17: 3,518,659 S1693R probably damaging Het
Usp48 A G 4: 137,650,360 D232G probably damaging Het
Wasf1 A G 10: 40,926,585 S79G probably damaging Het
Zfp90 G T 8: 106,425,316 D554Y probably damaging Het
Zfp90 A T 8: 106,425,317 D554V probably damaging Het
Zic5 T C 14: 122,459,548 T552A unknown Het
Zic5 CGACGAGTAG C 14: 122,459,555 probably benign Het
Other mutations in Prss55
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01638:Prss55 APN 14 64077187 missense probably benign 0.02
IGL02061:Prss55 APN 14 64075743 missense possibly damaging 0.60
IGL02625:Prss55 APN 14 64079369 missense probably damaging 1.00
IGL02901:Prss55 APN 14 64077127 missense probably damaging 1.00
IGL03407:Prss55 APN 14 64077090 missense probably damaging 1.00
R0271:Prss55 UTSW 14 64075607 missense probably benign 0.02
R0900:Prss55 UTSW 14 64077178 missense probably benign 0.00
R1299:Prss55 UTSW 14 64081698 missense probably damaging 1.00
R1740:Prss55 UTSW 14 64075680 missense probably damaging 1.00
R1789:Prss55 UTSW 14 64075730 missense probably damaging 1.00
R1899:Prss55 UTSW 14 64079390 missense probably benign 0.33
R2291:Prss55 UTSW 14 64075722 missense probably damaging 1.00
R5510:Prss55 UTSW 14 64077125 missense probably damaging 1.00
R7912:Prss55 UTSW 14 64081731 missense possibly damaging 0.85
R7952:Prss55 UTSW 14 64075683 missense probably damaging 1.00
R7980:Prss55 UTSW 14 64078689 splice site probably null
Predicted Primers PCR Primer
(F):5'- AAAGCCATTCCACTGCTCTC -3'
(R):5'- ATTGGCTTCTGTTCACTCGG -3'

Sequencing Primer
(F):5'- AGATCCCGTAGCTCTTGCC -3'
(R):5'- GCTTCTGTTCACTCGGGCTTC -3'
Posted On2018-11-28