Incidental Mutation 'R6977:Thpo'
ID542534
Institutional Source Beutler Lab
Gene Symbol Thpo
Ensembl Gene ENSMUSG00000022847
Gene Namethrombopoietin
SynonymsTPO-3, TPO-1, TPO-2, TPO, TPO-4, myeloproliferative leukemia virus oncogene ligand, Mpllg
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6977 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location20724454-20734511 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20725683 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 200 (L200P)
Ref Sequence ENSEMBL: ENSMUSP00000155914 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021405] [ENSMUST00000076422] [ENSMUST00000115437] [ENSMUST00000161038] [ENSMUST00000231392] [ENSMUST00000231656] [ENSMUST00000231826] [ENSMUST00000232217]
Predicted Effect probably benign
Transcript: ENSMUST00000021405
SMART Domains Protein: ENSMUSP00000021405
Gene: ENSMUSG00000021018

DomainStartEndE-ValueType
RPOL8c 2 147 5.28e-93 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000076422
AA Change: S266P

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000075756
Gene: ENSMUSG00000022847
AA Change: S266P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:EPO_TPO 24 188 9.4e-78 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000115437
AA Change: S266P

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000111097
Gene: ENSMUSG00000022847
AA Change: S266P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:EPO_TPO 25 193 5.4e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161038
Predicted Effect probably benign
Transcript: ENSMUST00000231392
Predicted Effect probably benign
Transcript: ENSMUST00000231656
Predicted Effect probably damaging
Transcript: ENSMUST00000231826
AA Change: L200P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000232217
AA Change: S295P

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a humoral growth factor necessary for megakaryocyte proliferation and maturation, as well as for thrombopoiesis. The encoded protein is a ligand for the product of the myeloproliferative leukemia virus oncogene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for targeted mutations at this locus are unable to produce normal amounts of megakaryocytes and platelets. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik G A 13: 59,691,580 S17L possibly damaging Het
Acap2 G T 16: 31,117,261 T336K probably damaging Het
Angptl7 A T 4: 148,497,393 W179R probably damaging Het
Atp9b A G 18: 80,753,102 F909L probably damaging Het
BC048403 A G 10: 121,745,466 H124R probably damaging Het
BC051665 A T 13: 60,784,672 Y66* probably null Het
C8b A G 4: 104,786,996 T287A possibly damaging Het
Camk2a G A 18: 60,960,004 G301E probably damaging Het
Ccdc186 A G 19: 56,798,787 M583T probably benign Het
Cd55b T A 1: 130,419,791 K94N probably damaging Het
Celsr3 T C 9: 108,827,715 S466P probably benign Het
Cep152 A G 2: 125,568,822 probably null Het
Cep70 A G 9: 99,291,676 D420G probably damaging Het
Cnih4 T C 1: 181,162,148 S48P possibly damaging Het
Cpne8 T C 15: 90,497,091 K507E probably benign Het
Cyp2b23 T C 7: 26,681,320 Y160C possibly damaging Het
Dnah9 C A 11: 66,107,909 M1104I probably benign Het
Fam135a T A 1: 24,054,098 N149I probably damaging Het
Fbxl4 A T 4: 22,376,930 Q122L probably benign Het
Gm11232 T C 4: 71,757,941 probably benign Het
Gm5901 A G 7: 105,377,160 Y45C probably benign Het
Gsap A T 5: 21,271,221 I553F probably damaging Het
Ifih1 A G 2: 62,606,186 F631S probably damaging Het
Kif21a T C 15: 90,980,837 D544G probably damaging Het
Klc2 G A 19: 5,109,365 R552C probably damaging Het
Lamp1 T C 8: 13,173,661 V293A probably damaging Het
Muc16 T A 9: 18,645,337 D3220V unknown Het
Myb A T 10: 21,152,652 I104K probably damaging Het
Mycbp2 C A 14: 103,154,906 R3227L probably damaging Het
Ncapd2 A T 6: 125,171,509 L1053Q probably damaging Het
Nelfe T A 17: 34,854,712 V316E probably damaging Het
Noxred1 T C 12: 87,221,317 I347V probably null Het
Olfr150 A G 9: 39,737,034 Y73C probably benign Het
Plekha7 A G 7: 116,135,967 V1033A probably benign Het
Plekhh1 G C 12: 79,065,717 W589C probably damaging Het
Ppp6r3 A T 19: 3,467,272 F658L probably damaging Het
Prss55 A G 14: 64,079,336 M119T probably damaging Het
Rab28 G A 5: 41,698,392 Q87* probably null Het
Rsf1 GGCG GGCGACGGCAGCG 7: 97,579,906 probably benign Het
Sdr16c6 A T 4: 4,076,865 F11L probably benign Het
Serpinb5 T G 1: 106,872,347 V89G probably benign Het
Slc12a9 A T 5: 137,315,813 V628E probably damaging Het
Slc25a34 G A 4: 141,620,498 R291C probably damaging Het
Slmap C T 14: 26,533,419 R36H probably damaging Het
Sybu A G 15: 44,677,695 S324P probably benign Het
Syk A T 13: 52,633,058 M363L probably benign Het
Tecpr2 T C 12: 110,939,766 V934A probably benign Het
Tiam2 T A 17: 3,518,659 S1693R probably damaging Het
Usp48 A G 4: 137,650,360 D232G probably damaging Het
Wasf1 A G 10: 40,926,585 S79G probably damaging Het
Zfp90 G T 8: 106,425,316 D554Y probably damaging Het
Zfp90 A T 8: 106,425,317 D554V probably damaging Het
Zic5 T C 14: 122,459,548 T552A unknown Het
Zic5 CGACGAGTAG C 14: 122,459,555 probably benign Het
Other mutations in Thpo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01085:Thpo APN 16 20728455 missense probably damaging 0.99
R1595:Thpo UTSW 16 20728456 missense probably damaging 1.00
R3838:Thpo UTSW 16 20728748 missense probably damaging 1.00
R5911:Thpo UTSW 16 20728796 missense probably null 1.00
R6113:Thpo UTSW 16 20728847 unclassified probably benign
R7769:Thpo UTSW 16 20725651 missense probably benign 0.00
R7862:Thpo UTSW 16 20728790 missense probably benign 0.06
R8079:Thpo UTSW 16 20726394 missense probably benign
R8281:Thpo UTSW 16 20725775 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- ACATTGTGACTGGATGAGGG -3'
(R):5'- CAGTGTCACAGCCAGAACTG -3'

Sequencing Primer
(F):5'- GCGGTAGAGTTAGGCATGG -3'
(R):5'- AACTGCTGGCCCTGGACTTC -3'
Posted On2018-11-28