Incidental Mutation 'R6977:Ppp6r3'
ID542540
Institutional Source Beutler Lab
Gene Symbol Ppp6r3
Ensembl Gene ENSMUSG00000024908
Gene Nameprotein phosphatase 6, regulatory subunit 3
SynonymsPp6r3, D19Ertd703e, D19Bwg1430e, 4930528G08Rik, Saps3, 9130026N02Rik, Pptcs3
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.865) question?
Stock #R6977 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location3454928-3575749 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 3467272 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 658 (F658L)
Ref Sequence ENSEMBL: ENSMUSP00000025846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025846] [ENSMUST00000113997] [ENSMUST00000172362] [ENSMUST00000225475]
Predicted Effect probably damaging
Transcript: ENSMUST00000025846
AA Change: F658L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025846
Gene: ENSMUSG00000024908
AA Change: F658L

DomainStartEndE-ValueType
coiled coil region 25 52 N/A INTRINSIC
Pfam:SAPS 128 365 2.7e-69 PFAM
Pfam:SAPS 360 513 1.4e-44 PFAM
low complexity region 609 627 N/A INTRINSIC
low complexity region 743 758 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113997
AA Change: F687L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109630
Gene: ENSMUSG00000024908
AA Change: F687L

DomainStartEndE-ValueType
coiled coil region 25 52 N/A INTRINSIC
Pfam:SAPS 128 365 5.8e-69 PFAM
Pfam:SAPS 363 513 2.7e-44 PFAM
low complexity region 638 656 N/A INTRINSIC
low complexity region 772 787 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172362
AA Change: F641L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000131084
Gene: ENSMUSG00000024908
AA Change: F641L

DomainStartEndE-ValueType
coiled coil region 25 52 N/A INTRINSIC
Pfam:SAPS 128 365 2.6e-69 PFAM
Pfam:SAPS 360 513 1.3e-44 PFAM
low complexity region 592 610 N/A INTRINSIC
low complexity region 726 741 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000225475
AA Change: F60L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein phosphatase regulatory subunits, such as SAPS3, modulate the activity of protein phosphatase catalytic subunits by restricting substrate specificity, recruiting substrates, and determining the intracellular localization of the holoenzyme. SAPS3 is a regulatory subunit for the protein phosphatase-6 catalytic subunit (PPP6C; MIM 612725) (Stefansson and Brautigan, 2006 [PubMed 16769727]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik G A 13: 59,691,580 S17L possibly damaging Het
Acap2 G T 16: 31,117,261 T336K probably damaging Het
Angptl7 A T 4: 148,497,393 W179R probably damaging Het
Atp9b A G 18: 80,753,102 F909L probably damaging Het
BC048403 A G 10: 121,745,466 H124R probably damaging Het
BC051665 A T 13: 60,784,672 Y66* probably null Het
C8b A G 4: 104,786,996 T287A possibly damaging Het
Camk2a G A 18: 60,960,004 G301E probably damaging Het
Ccdc186 A G 19: 56,798,787 M583T probably benign Het
Cd55b T A 1: 130,419,791 K94N probably damaging Het
Celsr3 T C 9: 108,827,715 S466P probably benign Het
Cep152 A G 2: 125,568,822 probably null Het
Cep70 A G 9: 99,291,676 D420G probably damaging Het
Cnih4 T C 1: 181,162,148 S48P possibly damaging Het
Cpne8 T C 15: 90,497,091 K507E probably benign Het
Cyp2b23 T C 7: 26,681,320 Y160C possibly damaging Het
Dnah9 C A 11: 66,107,909 M1104I probably benign Het
Fam135a T A 1: 24,054,098 N149I probably damaging Het
Fbxl4 A T 4: 22,376,930 Q122L probably benign Het
Gm11232 T C 4: 71,757,941 probably benign Het
Gm5901 A G 7: 105,377,160 Y45C probably benign Het
Gsap A T 5: 21,271,221 I553F probably damaging Het
Ifih1 A G 2: 62,606,186 F631S probably damaging Het
Kif21a T C 15: 90,980,837 D544G probably damaging Het
Klc2 G A 19: 5,109,365 R552C probably damaging Het
Lamp1 T C 8: 13,173,661 V293A probably damaging Het
Muc16 T A 9: 18,645,337 D3220V unknown Het
Myb A T 10: 21,152,652 I104K probably damaging Het
Mycbp2 C A 14: 103,154,906 R3227L probably damaging Het
Ncapd2 A T 6: 125,171,509 L1053Q probably damaging Het
Nelfe T A 17: 34,854,712 V316E probably damaging Het
Noxred1 T C 12: 87,221,317 I347V probably null Het
Olfr150 A G 9: 39,737,034 Y73C probably benign Het
Plekha7 A G 7: 116,135,967 V1033A probably benign Het
Plekhh1 G C 12: 79,065,717 W589C probably damaging Het
Prss55 A G 14: 64,079,336 M119T probably damaging Het
Rab28 G A 5: 41,698,392 Q87* probably null Het
Rsf1 GGCG GGCGACGGCAGCG 7: 97,579,906 probably benign Het
Sdr16c6 A T 4: 4,076,865 F11L probably benign Het
Serpinb5 T G 1: 106,872,347 V89G probably benign Het
Slc12a9 A T 5: 137,315,813 V628E probably damaging Het
Slc25a34 G A 4: 141,620,498 R291C probably damaging Het
Slmap C T 14: 26,533,419 R36H probably damaging Het
Sybu A G 15: 44,677,695 S324P probably benign Het
Syk A T 13: 52,633,058 M363L probably benign Het
Tecpr2 T C 12: 110,939,766 V934A probably benign Het
Thpo A G 16: 20,725,683 L200P probably damaging Het
Tiam2 T A 17: 3,518,659 S1693R probably damaging Het
Usp48 A G 4: 137,650,360 D232G probably damaging Het
Wasf1 A G 10: 40,926,585 S79G probably damaging Het
Zfp90 G T 8: 106,425,316 D554Y probably damaging Het
Zfp90 A T 8: 106,425,317 D554V probably damaging Het
Zic5 T C 14: 122,459,548 T552A unknown Het
Zic5 CGACGAGTAG C 14: 122,459,555 probably benign Het
Other mutations in Ppp6r3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Ppp6r3 APN 19 3514729 splice site probably null
IGL00340:Ppp6r3 APN 19 3518324 missense probably damaging 1.00
IGL00585:Ppp6r3 APN 19 3490826 missense probably damaging 0.99
IGL01304:Ppp6r3 APN 19 3467261 missense probably damaging 0.99
IGL02048:Ppp6r3 APN 19 3473848 missense possibly damaging 0.96
IGL02055:Ppp6r3 APN 19 3521781 missense probably benign 0.01
IGL02108:Ppp6r3 APN 19 3492494 missense probably damaging 1.00
IGL02227:Ppp6r3 APN 19 3518245 missense possibly damaging 0.56
IGL02427:Ppp6r3 APN 19 3466580 missense probably null
IGL02441:Ppp6r3 APN 19 3464693 missense probably benign 0.14
IGL02805:Ppp6r3 APN 19 3492428 missense probably benign 0.15
IGL03298:Ppp6r3 APN 19 3521829 missense probably damaging 0.97
PIT1430001:Ppp6r3 UTSW 19 3471059 nonsense probably null
R0324:Ppp6r3 UTSW 19 3464693 missense probably benign 0.00
R0362:Ppp6r3 UTSW 19 3478285 missense probably damaging 0.96
R1876:Ppp6r3 UTSW 19 3471971 splice site probably benign
R2860:Ppp6r3 UTSW 19 3521782 missense possibly damaging 0.49
R2861:Ppp6r3 UTSW 19 3521782 missense possibly damaging 0.49
R2862:Ppp6r3 UTSW 19 3521782 missense possibly damaging 0.49
R3958:Ppp6r3 UTSW 19 3496583 missense probably damaging 0.99
R4158:Ppp6r3 UTSW 19 3512037 missense probably damaging 0.97
R4160:Ppp6r3 UTSW 19 3512037 missense probably damaging 0.97
R4473:Ppp6r3 UTSW 19 3511978 missense probably damaging 1.00
R4901:Ppp6r3 UTSW 19 3467229 missense probably damaging 1.00
R4996:Ppp6r3 UTSW 19 3473833 missense probably damaging 0.98
R5139:Ppp6r3 UTSW 19 3464610 missense probably damaging 1.00
R5414:Ppp6r3 UTSW 19 3507330 missense probably damaging 1.00
R5776:Ppp6r3 UTSW 19 3526901 missense possibly damaging 0.77
R6290:Ppp6r3 UTSW 19 3494011 missense probably benign
R6525:Ppp6r3 UTSW 19 3493936 missense probably damaging 0.99
R6797:Ppp6r3 UTSW 19 3514719 missense probably damaging 1.00
R7176:Ppp6r3 UTSW 19 3471989 missense probably damaging 0.99
R7178:Ppp6r3 UTSW 19 3518337 missense probably benign 0.00
R7239:Ppp6r3 UTSW 19 3493981 missense probably benign 0.38
R7326:Ppp6r3 UTSW 19 3507325 missense probably damaging 1.00
R7536:Ppp6r3 UTSW 19 3507341 missense possibly damaging 0.80
R7583:Ppp6r3 UTSW 19 3490790 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTCTCAGTCGTTCCTCAGAG -3'
(R):5'- TTGAGGGTACATGAGGTCTGCC -3'

Sequencing Primer
(F):5'- AGGCACATGCACTTCCTG -3'
(R):5'- AGGTCTGCCTCAGCTCAGATC -3'
Posted On2018-11-28