Incidental Mutation 'R6978:Olfr538'
ID542565
Institutional Source Beutler Lab
Gene Symbol Olfr538
Ensembl Gene ENSMUSG00000095901
Gene Nameolfactory receptor 538
SynonymsMOR253-13P, MOR253-13P, GA_x6K02T2PBJ9-42723314-42724246, MOR253-10P, Olfr1553-ps1, MOR253-12P, Olfr1523-ps1, MOR253-12P
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R6978 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location140567886-140575793 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 140574287 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 45 (I45L)
Ref Sequence ENSEMBL: ENSMUSP00000147315 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084457] [ENSMUST00000210973]
Predicted Effect probably damaging
Transcript: ENSMUST00000084457
AA Change: I45L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000081495
Gene: ENSMUSG00000095901
AA Change: I45L

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 5e-50 PFAM
Pfam:7TM_GPCR_Srsx 35 304 2.8e-6 PFAM
Pfam:7tm_1 41 290 2.5e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000210973
AA Change: I45L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Meta Mutation Damage Score 0.2133 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency 96% (51/53)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T C 18: 12,185,747 Y430H probably benign Het
6430628N08Rik C T 4: 115,898,363 Q120* probably null Het
Adprh C T 16: 38,445,809 G324S probably damaging Het
Amfr T C 8: 94,000,387 E140G probably damaging Het
Anapc1 G T 2: 128,669,900 Q458K probably benign Het
Ap1g1 T C 8: 109,828,336 probably null Het
Arhgap45 G T 10: 80,021,848 V211F probably benign Het
Baz2b T C 2: 59,907,715 E1750G possibly damaging Het
Cmpk2 A T 12: 26,477,019 T336S probably damaging Het
Col6a3 C T 1: 90,807,470 probably null Het
Cyp2c29 T C 19: 39,321,663 L272P probably damaging Het
Cyp3a13 A T 5: 137,905,539 S286T probably benign Het
Cyp4f18 T G 8: 72,002,496 S79R probably benign Het
Dio1 T C 4: 107,306,833 T96A probably benign Het
Dnah7a T C 1: 53,662,367 I210V probably null Het
Epha4 A G 1: 77,377,583 Y841H probably damaging Het
Gm10471 C A 5: 26,086,456 E117D probably damaging Het
Gm12695 T C 4: 96,769,722 D70G possibly damaging Het
Gtf3c1 G T 7: 125,645,534 T1680K possibly damaging Het
Hnrnpul2 T C 19: 8,824,276 V314A probably damaging Het
Irx3 G T 8: 91,800,728 P116Q probably damaging Het
Lrp4 C T 2: 91,491,998 R1060C probably damaging Het
Mark3 G A 12: 111,627,148 V205I probably benign Het
Mchr1 T C 15: 81,237,796 L249P possibly damaging Het
Med26 T C 8: 72,496,583 N224S possibly damaging Het
Megf9 C T 4: 70,433,529 V452I probably benign Het
Mki67 T C 7: 135,701,962 R726G probably benign Het
Mst1r T A 9: 107,912,594 L583Q probably benign Het
Mybpc1 A G 10: 88,523,024 C1102R probably damaging Het
Nr6a1 T C 2: 38,872,619 T55A probably benign Het
Nup210l G A 3: 90,154,566 R684Q possibly damaging Het
Olfr1303 T A 2: 111,813,810 L305F probably benign Het
Olfr986 C T 9: 40,187,789 R225W probably damaging Het
Pgbd1 A G 13: 21,423,262 L254P probably damaging Het
Pou6f2 A G 13: 18,172,478 F10L probably damaging Het
Ppfia3 T A 7: 45,346,848 T726S probably benign Het
Rab21 T A 10: 115,298,861 M118L possibly damaging Het
Rbm6 T C 9: 107,852,575 probably null Het
Rpp38 A G 2: 3,329,721 L48P probably damaging Het
Sart3 A T 5: 113,745,746 I735N probably damaging Het
Slc44a1 T A 4: 53,544,671 Y461N probably damaging Het
Smok2b A T 17: 13,236,408 *485L probably null Het
Spink8 T C 9: 109,820,657 V69A probably benign Het
Spred2 G A 11: 19,998,254 R83Q possibly damaging Het
Tmc1 T C 19: 20,804,635 N573S probably damaging Het
Tox4 G T 14: 52,287,237 probably null Het
Unc13c T C 9: 73,931,977 S531G probably benign Het
Vmn2r56 C T 7: 12,715,406 V302I probably benign Het
Ypel1 C T 16: 17,084,574 A110V probably benign Het
Zfp395 G A 14: 65,386,433 R117H probably benign Het
Zic5 T C 14: 122,459,548 T552A unknown Het
Zic5 CGACGAGTAG C 14: 122,459,555 probably benign Het
Other mutations in Olfr538
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01894:Olfr538 APN 7 140574770 missense possibly damaging 0.93
IGL02066:Olfr538 APN 7 140574500 missense possibly damaging 0.55
IGL02214:Olfr538 APN 7 140574557 nonsense probably null
IGL02466:Olfr538 APN 7 140574771 missense probably benign 0.01
IGL02534:Olfr538 APN 7 140574641 missense probably benign 0.00
R0631:Olfr538 UTSW 7 140574507 missense probably damaging 1.00
R0989:Olfr538 UTSW 7 140574287 missense probably damaging 0.99
R1470:Olfr538 UTSW 7 140574749 missense probably benign 0.02
R1470:Olfr538 UTSW 7 140574749 missense probably benign 0.02
R1533:Olfr538 UTSW 7 140575121 unclassified probably null
R1764:Olfr538 UTSW 7 140574470 missense probably damaging 0.97
R2184:Olfr538 UTSW 7 140574402 missense probably benign
R2513:Olfr538 UTSW 7 140574156 start codon destroyed probably null 0.97
R4445:Olfr538 UTSW 7 140574389 missense probably damaging 1.00
R4476:Olfr538 UTSW 7 140574929 missense probably damaging 1.00
R4607:Olfr538 UTSW 7 140574641 missense probably benign 0.02
R4608:Olfr538 UTSW 7 140574641 missense probably benign 0.02
R4752:Olfr538 UTSW 7 140574602 missense possibly damaging 0.57
R6934:Olfr538 UTSW 7 140574651 missense probably damaging 1.00
R7559:Olfr538 UTSW 7 140574443 missense probably damaging 1.00
R7583:Olfr538 UTSW 7 140574210 missense probably benign 0.01
R7685:Olfr538 UTSW 7 140574246 missense probably damaging 1.00
Z1177:Olfr538 UTSW 7 140574956 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- AATCCACACCTCTATGAACTGG -3'
(R):5'- CGGTCATAGGCCATAACTGTG -3'

Sequencing Primer
(F):5'- CCTCTATGAACTGGATACTCCAC -3'
(R):5'- TCATAGGCCATAACTGTGAGCAGC -3'
Posted On2018-11-28