Incidental Mutation 'R6978:Arhgap45'
ID542575
Institutional Source Beutler Lab
Gene Symbol Arhgap45
Ensembl Gene ENSMUSG00000035697
Gene NameRho GTPase activating protein 45
Synonyms6330406L22Rik, Hmha1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6978 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location80016653-80031472 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 80021848 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 211 (V211F)
Ref Sequence ENSEMBL: ENSMUSP00000041019 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043311] [ENSMUST00000099501] [ENSMUST00000105373]
Predicted Effect probably benign
Transcript: ENSMUST00000043311
AA Change: V211F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000041019
Gene: ENSMUSG00000035697
AA Change: V211F

DomainStartEndE-ValueType
low complexity region 142 153 N/A INTRINSIC
FCH 157 244 4.14e-17 SMART
low complexity region 255 269 N/A INTRINSIC
low complexity region 309 324 N/A INTRINSIC
low complexity region 330 345 N/A INTRINSIC
low complexity region 527 536 N/A INTRINSIC
C1 582 628 3.15e-8 SMART
RhoGAP 653 852 2.73e-73 SMART
low complexity region 856 869 N/A INTRINSIC
Blast:RhoGAP 876 999 1e-21 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000099501
AA Change: V327F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097100
Gene: ENSMUSG00000035697
AA Change: V327F

DomainStartEndE-ValueType
low complexity region 258 269 N/A INTRINSIC
FCH 273 360 4.14e-17 SMART
low complexity region 371 385 N/A INTRINSIC
low complexity region 425 440 N/A INTRINSIC
low complexity region 446 461 N/A INTRINSIC
low complexity region 643 652 N/A INTRINSIC
C1 698 744 3.15e-8 SMART
RhoGAP 769 968 2.73e-73 SMART
low complexity region 972 985 N/A INTRINSIC
Blast:RhoGAP 992 1115 1e-21 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000105373
AA Change: V338F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101012
Gene: ENSMUSG00000035697
AA Change: V338F

DomainStartEndE-ValueType
low complexity region 269 280 N/A INTRINSIC
FCH 284 371 4.14e-17 SMART
low complexity region 382 396 N/A INTRINSIC
low complexity region 436 451 N/A INTRINSIC
low complexity region 457 472 N/A INTRINSIC
low complexity region 654 663 N/A INTRINSIC
C1 709 755 3.15e-8 SMART
RhoGAP 780 979 2.73e-73 SMART
low complexity region 983 996 N/A INTRINSIC
Blast:RhoGAP 1003 1126 1e-21 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency 96% (51/53)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T C 18: 12,185,747 Y430H probably benign Het
6430628N08Rik C T 4: 115,898,363 Q120* probably null Het
Adprh C T 16: 38,445,809 G324S probably damaging Het
Amfr T C 8: 94,000,387 E140G probably damaging Het
Anapc1 G T 2: 128,669,900 Q458K probably benign Het
Ap1g1 T C 8: 109,828,336 probably null Het
Baz2b T C 2: 59,907,715 E1750G possibly damaging Het
Cmpk2 A T 12: 26,477,019 T336S probably damaging Het
Col6a3 C T 1: 90,807,470 probably null Het
Cyp2c29 T C 19: 39,321,663 L272P probably damaging Het
Cyp3a13 A T 5: 137,905,539 S286T probably benign Het
Cyp4f18 T G 8: 72,002,496 S79R probably benign Het
Dio1 T C 4: 107,306,833 T96A probably benign Het
Dnah7a T C 1: 53,662,367 I210V probably null Het
Epha4 A G 1: 77,377,583 Y841H probably damaging Het
Gm10471 C A 5: 26,086,456 E117D probably damaging Het
Gm12695 T C 4: 96,769,722 D70G possibly damaging Het
Gtf3c1 G T 7: 125,645,534 T1680K possibly damaging Het
Hnrnpul2 T C 19: 8,824,276 V314A probably damaging Het
Irx3 G T 8: 91,800,728 P116Q probably damaging Het
Lrp4 C T 2: 91,491,998 R1060C probably damaging Het
Mark3 G A 12: 111,627,148 V205I probably benign Het
Mchr1 T C 15: 81,237,796 L249P possibly damaging Het
Med26 T C 8: 72,496,583 N224S possibly damaging Het
Megf9 C T 4: 70,433,529 V452I probably benign Het
Mki67 T C 7: 135,701,962 R726G probably benign Het
Mst1r T A 9: 107,912,594 L583Q probably benign Het
Mybpc1 A G 10: 88,523,024 C1102R probably damaging Het
Nr6a1 T C 2: 38,872,619 T55A probably benign Het
Nup210l G A 3: 90,154,566 R684Q possibly damaging Het
Olfr1303 T A 2: 111,813,810 L305F probably benign Het
Olfr538 A C 7: 140,574,287 I45L probably damaging Het
Olfr986 C T 9: 40,187,789 R225W probably damaging Het
Pgbd1 A G 13: 21,423,262 L254P probably damaging Het
Pou6f2 A G 13: 18,172,478 F10L probably damaging Het
Ppfia3 T A 7: 45,346,848 T726S probably benign Het
Rab21 T A 10: 115,298,861 M118L possibly damaging Het
Rbm6 T C 9: 107,852,575 probably null Het
Rpp38 A G 2: 3,329,721 L48P probably damaging Het
Sart3 A T 5: 113,745,746 I735N probably damaging Het
Slc44a1 T A 4: 53,544,671 Y461N probably damaging Het
Smok2b A T 17: 13,236,408 *485L probably null Het
Spink8 T C 9: 109,820,657 V69A probably benign Het
Spred2 G A 11: 19,998,254 R83Q possibly damaging Het
Tmc1 T C 19: 20,804,635 N573S probably damaging Het
Tox4 G T 14: 52,287,237 probably null Het
Unc13c T C 9: 73,931,977 S531G probably benign Het
Vmn2r56 C T 7: 12,715,406 V302I probably benign Het
Ypel1 C T 16: 17,084,574 A110V probably benign Het
Zfp395 G A 14: 65,386,433 R117H probably benign Het
Zic5 T C 14: 122,459,548 T552A unknown Het
Zic5 CGACGAGTAG C 14: 122,459,555 probably benign Het
Other mutations in Arhgap45
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01360:Arhgap45 APN 10 80028648 splice site probably benign
IGL01414:Arhgap45 APN 10 80027104 missense probably damaging 1.00
IGL01505:Arhgap45 APN 10 80026542 missense probably benign 0.10
IGL02203:Arhgap45 APN 10 80027553 nonsense probably null
IGL02557:Arhgap45 APN 10 80021638 missense probably damaging 1.00
IGL02858:Arhgap45 APN 10 80017934 missense probably benign 0.20
IGL03292:Arhgap45 APN 10 80020969 missense probably benign 0.04
IGL03352:Arhgap45 APN 10 80030751 missense probably damaging 0.96
Celt UTSW 10 80020818 missense probably damaging 1.00
druid UTSW 10 80026347 critical splice donor site probably null
Mistletoe UTSW 10 80027102 nonsense probably null
Roman UTSW 10 80027597 missense probably damaging 1.00
stonehenge UTSW 10 80025482 missense possibly damaging 0.81
IGL03048:Arhgap45 UTSW 10 80017017 missense probably damaging 0.99
PIT4677001:Arhgap45 UTSW 10 80020749 missense probably benign
R0532:Arhgap45 UTSW 10 80022083 missense possibly damaging 0.92
R1233:Arhgap45 UTSW 10 80027582 missense probably damaging 1.00
R1579:Arhgap45 UTSW 10 80028977 missense probably damaging 1.00
R1666:Arhgap45 UTSW 10 80028750 missense possibly damaging 0.82
R1668:Arhgap45 UTSW 10 80028750 missense possibly damaging 0.82
R1688:Arhgap45 UTSW 10 80029095 missense probably damaging 1.00
R1710:Arhgap45 UTSW 10 80018098 nonsense probably null
R1902:Arhgap45 UTSW 10 80025466 missense probably damaging 0.99
R1912:Arhgap45 UTSW 10 80020690 missense probably benign 0.08
R1935:Arhgap45 UTSW 10 80030954 missense probably damaging 1.00
R1936:Arhgap45 UTSW 10 80030954 missense probably damaging 1.00
R1955:Arhgap45 UTSW 10 80026492 missense probably benign 0.15
R1968:Arhgap45 UTSW 10 80027702 missense probably damaging 1.00
R1977:Arhgap45 UTSW 10 80020818 missense probably damaging 1.00
R1986:Arhgap45 UTSW 10 80020696 missense probably damaging 1.00
R2074:Arhgap45 UTSW 10 80027180 missense probably damaging 1.00
R2081:Arhgap45 UTSW 10 80027674 missense probably damaging 1.00
R2162:Arhgap45 UTSW 10 80016979 start codon destroyed probably null 0.02
R2937:Arhgap45 UTSW 10 80029002 missense probably damaging 1.00
R2938:Arhgap45 UTSW 10 80029002 missense probably damaging 1.00
R3081:Arhgap45 UTSW 10 80026447 missense probably damaging 1.00
R4695:Arhgap45 UTSW 10 80025530 missense probably damaging 1.00
R4736:Arhgap45 UTSW 10 80026172 missense probably damaging 1.00
R4758:Arhgap45 UTSW 10 80030293 missense probably benign 0.00
R4860:Arhgap45 UTSW 10 80027066 missense probably damaging 1.00
R4860:Arhgap45 UTSW 10 80027066 missense probably damaging 1.00
R4934:Arhgap45 UTSW 10 80020957 missense probably damaging 1.00
R4943:Arhgap45 UTSW 10 80026503 missense probably benign 0.00
R5102:Arhgap45 UTSW 10 80021428 missense probably benign 0.01
R5128:Arhgap45 UTSW 10 80030959 missense probably benign 0.16
R5667:Arhgap45 UTSW 10 80025476 missense probably damaging 1.00
R5671:Arhgap45 UTSW 10 80025476 missense probably damaging 1.00
R5920:Arhgap45 UTSW 10 80029131 missense possibly damaging 0.87
R5998:Arhgap45 UTSW 10 80030950 missense probably damaging 0.99
R6276:Arhgap45 UTSW 10 80026234 missense probably benign 0.25
R6675:Arhgap45 UTSW 10 80018104 missense probably null 0.98
R6738:Arhgap45 UTSW 10 80027597 missense probably damaging 1.00
R6783:Arhgap45 UTSW 10 80017864 missense possibly damaging 0.92
R6863:Arhgap45 UTSW 10 80017782 missense probably benign 0.03
R7089:Arhgap45 UTSW 10 80026347 critical splice donor site probably null
R7215:Arhgap45 UTSW 10 80025482 missense possibly damaging 0.81
R7307:Arhgap45 UTSW 10 80029182 missense probably benign 0.14
R7308:Arhgap45 UTSW 10 80026558 critical splice donor site probably null
R7480:Arhgap45 UTSW 10 80027102 nonsense probably null
R7481:Arhgap45 UTSW 10 80022300 missense possibly damaging 0.80
R7649:Arhgap45 UTSW 10 80031001 missense probably benign 0.00
R7652:Arhgap45 UTSW 10 80028838 missense probably benign 0.01
R7748:Arhgap45 UTSW 10 80016932 unclassified probably benign
R7883:Arhgap45 UTSW 10 80027589 nonsense probably null
R7966:Arhgap45 UTSW 10 80027589 nonsense probably null
X0023:Arhgap45 UTSW 10 80030800 missense probably damaging 0.98
X0063:Arhgap45 UTSW 10 80030356 missense possibly damaging 0.51
Z1176:Arhgap45 UTSW 10 80025536 missense probably damaging 1.00
Z1176:Arhgap45 UTSW 10 80029052 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCAAAAGACATGGCCAGGTAC -3'
(R):5'- GCCACTCTTAGCAACCGATG -3'

Sequencing Primer
(F):5'- CTCATCAGCTACCTGGAGAAGAG -3'
(R):5'- TCTTAGCAACCGATGGGCATC -3'
Posted On2018-11-28