Incidental Mutation 'R6978:Zfp395'
ID542583
Institutional Source Beutler Lab
Gene Symbol Zfp395
Ensembl Gene ENSMUSG00000034522
Gene Namezinc finger protein 395
SynonymsLOC380912, BC027382
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6978 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location65358389-65398930 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 65386433 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 117 (R117H)
Ref Sequence ENSEMBL: ENSMUSP00000064422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066994] [ENSMUST00000224623] [ENSMUST00000224687]
Predicted Effect probably benign
Transcript: ENSMUST00000066994
AA Change: R117H

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000064422
Gene: ENSMUSG00000034522
AA Change: R117H

DomainStartEndE-ValueType
Pfam:DUF4772 2 110 5.3e-31 PFAM
low complexity region 162 174 N/A INTRINSIC
low complexity region 208 234 N/A INTRINSIC
ZnF_C2H2 279 304 1.25e-1 SMART
low complexity region 356 367 N/A INTRINSIC
low complexity region 429 446 N/A INTRINSIC
c-clamp 478 508 1.88e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000224623
Predicted Effect probably benign
Transcript: ENSMUST00000224687
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency 96% (51/53)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T C 18: 12,185,747 Y430H probably benign Het
6430628N08Rik C T 4: 115,898,363 Q120* probably null Het
Adprh C T 16: 38,445,809 G324S probably damaging Het
Amfr T C 8: 94,000,387 E140G probably damaging Het
Anapc1 G T 2: 128,669,900 Q458K probably benign Het
Ap1g1 T C 8: 109,828,336 probably null Het
Arhgap45 G T 10: 80,021,848 V211F probably benign Het
Baz2b T C 2: 59,907,715 E1750G possibly damaging Het
Cmpk2 A T 12: 26,477,019 T336S probably damaging Het
Col6a3 C T 1: 90,807,470 probably null Het
Cyp2c29 T C 19: 39,321,663 L272P probably damaging Het
Cyp3a13 A T 5: 137,905,539 S286T probably benign Het
Cyp4f18 T G 8: 72,002,496 S79R probably benign Het
Dio1 T C 4: 107,306,833 T96A probably benign Het
Dnah7a T C 1: 53,662,367 I210V probably null Het
Epha4 A G 1: 77,377,583 Y841H probably damaging Het
Gm10471 C A 5: 26,086,456 E117D probably damaging Het
Gm12695 T C 4: 96,769,722 D70G possibly damaging Het
Gtf3c1 G T 7: 125,645,534 T1680K possibly damaging Het
Hnrnpul2 T C 19: 8,824,276 V314A probably damaging Het
Irx3 G T 8: 91,800,728 P116Q probably damaging Het
Lrp4 C T 2: 91,491,998 R1060C probably damaging Het
Mark3 G A 12: 111,627,148 V205I probably benign Het
Mchr1 T C 15: 81,237,796 L249P possibly damaging Het
Med26 T C 8: 72,496,583 N224S possibly damaging Het
Megf9 C T 4: 70,433,529 V452I probably benign Het
Mki67 T C 7: 135,701,962 R726G probably benign Het
Mst1r T A 9: 107,912,594 L583Q probably benign Het
Mybpc1 A G 10: 88,523,024 C1102R probably damaging Het
Nr6a1 T C 2: 38,872,619 T55A probably benign Het
Nup210l G A 3: 90,154,566 R684Q possibly damaging Het
Olfr1303 T A 2: 111,813,810 L305F probably benign Het
Olfr538 A C 7: 140,574,287 I45L probably damaging Het
Olfr986 C T 9: 40,187,789 R225W probably damaging Het
Pgbd1 A G 13: 21,423,262 L254P probably damaging Het
Pou6f2 A G 13: 18,172,478 F10L probably damaging Het
Ppfia3 T A 7: 45,346,848 T726S probably benign Het
Rab21 T A 10: 115,298,861 M118L possibly damaging Het
Rbm6 T C 9: 107,852,575 probably null Het
Rpp38 A G 2: 3,329,721 L48P probably damaging Het
Sart3 A T 5: 113,745,746 I735N probably damaging Het
Slc44a1 T A 4: 53,544,671 Y461N probably damaging Het
Smok2b A T 17: 13,236,408 *485L probably null Het
Spink8 T C 9: 109,820,657 V69A probably benign Het
Spred2 G A 11: 19,998,254 R83Q possibly damaging Het
Tmc1 T C 19: 20,804,635 N573S probably damaging Het
Tox4 G T 14: 52,287,237 probably null Het
Unc13c T C 9: 73,931,977 S531G probably benign Het
Vmn2r56 C T 7: 12,715,406 V302I probably benign Het
Ypel1 C T 16: 17,084,574 A110V probably benign Het
Zic5 T C 14: 122,459,548 T552A unknown Het
Zic5 CGACGAGTAG C 14: 122,459,555 probably benign Het
Other mutations in Zfp395
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01301:Zfp395 APN 14 65394751 splice site probably null
IGL01712:Zfp395 APN 14 65386387 missense probably damaging 0.98
IGL02885:Zfp395 APN 14 65395895 missense probably benign 0.05
R0243:Zfp395 UTSW 14 65386480 missense probably benign
R1540:Zfp395 UTSW 14 65393074 missense probably benign
R2005:Zfp395 UTSW 14 65388885 missense possibly damaging 0.87
R2108:Zfp395 UTSW 14 65393116 missense probably benign 0.24
R3499:Zfp395 UTSW 14 65391293 missense possibly damaging 0.87
R4790:Zfp395 UTSW 14 65386541 missense possibly damaging 0.74
R4790:Zfp395 UTSW 14 65393207 missense probably damaging 1.00
RF024:Zfp395 UTSW 14 65385425 missense unknown
Predicted Primers PCR Primer
(F):5'- ACAGATCTCCGAGGGCTTTG -3'
(R):5'- AAAGGATGCCTCTTCTGTACCTC -3'

Sequencing Primer
(F):5'- GGTGTGGAAACTCCTGAGC -3'
(R):5'- GTACCTCGCTCCACTATCCCATC -3'
Posted On2018-11-28