Incidental Mutation 'R6978:Zic5'
ID542584
Institutional Source Beutler Lab
Gene Symbol Zic5
Ensembl Gene ENSMUSG00000041703
Gene Namezinc finger protein of the cerebellum 5
Synonymsodd-paired related, 1700049L20Rik, Opr
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6978 (G1)
Quality Score221.009
Status Validated
Chromosome14
Chromosomal Location122456795-122465677 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 122459548 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 552 (T552A)
Ref Sequence ENSEMBL: ENSMUSP00000035754 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039118]
Predicted Effect unknown
Transcript: ENSMUST00000039118
AA Change: T552A
SMART Domains Protein: ENSMUSP00000035754
Gene: ENSMUSG00000041703
AA Change: T552A

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
low complexity region 116 154 N/A INTRINSIC
low complexity region 160 171 N/A INTRINSIC
low complexity region 182 192 N/A INTRINSIC
low complexity region 200 214 N/A INTRINSIC
low complexity region 284 303 N/A INTRINSIC
low complexity region 309 353 N/A INTRINSIC
ZnF_C2H2 390 408 2.2e2 SMART
ZnF_C2H2 417 444 2.14e0 SMART
ZnF_C2H2 450 474 8.02e-5 SMART
ZnF_C2H2 480 504 2.53e-2 SMART
ZnF_C2H2 510 534 7.49e-5 SMART
Meta Mutation Damage Score 0.0911 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency 96% (51/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ZIC family of C2H2-type zinc finger proteins. Members of this family are important during development, and have been associated X-linked visceral heterotaxy and holoprosencephaly type 5. This gene is closely linked to a gene encoding zinc finger protein of the cerebellum 2, a related family member on chromosome 13. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display postnatal lethality and reduced life spans with exencephaly, abnormal cerebral cortex and diencephalon morphology, abnormal gait and posture, and impaired growth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T C 18: 12,185,747 Y430H probably benign Het
6430628N08Rik C T 4: 115,898,363 Q120* probably null Het
Adprh C T 16: 38,445,809 G324S probably damaging Het
Amfr T C 8: 94,000,387 E140G probably damaging Het
Anapc1 G T 2: 128,669,900 Q458K probably benign Het
Ap1g1 T C 8: 109,828,336 probably null Het
Arhgap45 G T 10: 80,021,848 V211F probably benign Het
Baz2b T C 2: 59,907,715 E1750G possibly damaging Het
Cmpk2 A T 12: 26,477,019 T336S probably damaging Het
Col6a3 C T 1: 90,807,470 probably null Het
Cyp2c29 T C 19: 39,321,663 L272P probably damaging Het
Cyp3a13 A T 5: 137,905,539 S286T probably benign Het
Cyp4f18 T G 8: 72,002,496 S79R probably benign Het
Dio1 T C 4: 107,306,833 T96A probably benign Het
Dnah7a T C 1: 53,662,367 I210V probably null Het
Epha4 A G 1: 77,377,583 Y841H probably damaging Het
Gm10471 C A 5: 26,086,456 E117D probably damaging Het
Gm12695 T C 4: 96,769,722 D70G possibly damaging Het
Gtf3c1 G T 7: 125,645,534 T1680K possibly damaging Het
Hnrnpul2 T C 19: 8,824,276 V314A probably damaging Het
Irx3 G T 8: 91,800,728 P116Q probably damaging Het
Lrp4 C T 2: 91,491,998 R1060C probably damaging Het
Mark3 G A 12: 111,627,148 V205I probably benign Het
Mchr1 T C 15: 81,237,796 L249P possibly damaging Het
Med26 T C 8: 72,496,583 N224S possibly damaging Het
Megf9 C T 4: 70,433,529 V452I probably benign Het
Mki67 T C 7: 135,701,962 R726G probably benign Het
Mst1r T A 9: 107,912,594 L583Q probably benign Het
Mybpc1 A G 10: 88,523,024 C1102R probably damaging Het
Nr6a1 T C 2: 38,872,619 T55A probably benign Het
Nup210l G A 3: 90,154,566 R684Q possibly damaging Het
Olfr1303 T A 2: 111,813,810 L305F probably benign Het
Olfr538 A C 7: 140,574,287 I45L probably damaging Het
Olfr986 C T 9: 40,187,789 R225W probably damaging Het
Pgbd1 A G 13: 21,423,262 L254P probably damaging Het
Pou6f2 A G 13: 18,172,478 F10L probably damaging Het
Ppfia3 T A 7: 45,346,848 T726S probably benign Het
Rab21 T A 10: 115,298,861 M118L possibly damaging Het
Rbm6 T C 9: 107,852,575 probably null Het
Rpp38 A G 2: 3,329,721 L48P probably damaging Het
Sart3 A T 5: 113,745,746 I735N probably damaging Het
Slc44a1 T A 4: 53,544,671 Y461N probably damaging Het
Smok2b A T 17: 13,236,408 *485L probably null Het
Spink8 T C 9: 109,820,657 V69A probably benign Het
Spred2 G A 11: 19,998,254 R83Q possibly damaging Het
Tmc1 T C 19: 20,804,635 N573S probably damaging Het
Tox4 G T 14: 52,287,237 probably null Het
Unc13c T C 9: 73,931,977 S531G probably benign Het
Vmn2r56 C T 7: 12,715,406 V302I probably benign Het
Ypel1 C T 16: 17,084,574 A110V probably benign Het
Zfp395 G A 14: 65,386,433 R117H probably benign Het
Other mutations in Zic5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02157:Zic5 APN 14 122459512 missense unknown
Ezekiel UTSW 14 122465154 missense unknown
R0227:Zic5 UTSW 14 122459661 missense unknown
R0646:Zic5 UTSW 14 122463939 missense unknown
R1327:Zic5 UTSW 14 122459779 splice site probably benign
R1387:Zic5 UTSW 14 122459485 missense unknown
R1665:Zic5 UTSW 14 122459527 missense unknown
R2020:Zic5 UTSW 14 122464830 missense unknown
R2571:Zic5 UTSW 14 122459478 missense unknown
R4241:Zic5 UTSW 14 122464663 missense probably benign 0.03
R4610:Zic5 UTSW 14 122464800 missense probably damaging 0.98
R4706:Zic5 UTSW 14 122459557 missense unknown
R5496:Zic5 UTSW 14 122459343 missense unknown
R6178:Zic5 UTSW 14 122459336 missense unknown
R6189:Zic5 UTSW 14 122464974 missense unknown
R6332:Zic5 UTSW 14 122459749 missense unknown
R6485:Zic5 UTSW 14 122459640 missense unknown
R6564:Zic5 UTSW 14 122459421 missense unknown
R6677:Zic5 UTSW 14 122465154 missense unknown
R6877:Zic5 UTSW 14 122459688 missense unknown
R6977:Zic5 UTSW 14 122459548 missense unknown
R6977:Zic5 UTSW 14 122459555 small deletion probably benign
R6978:Zic5 UTSW 14 122459555 small deletion probably benign
R6996:Zic5 UTSW 14 122464668 missense probably benign 0.02
R7713:Zic5 UTSW 14 122464113 missense unknown
R8492:Zic5 UTSW 14 122465062 missense unknown
Predicted Primers PCR Primer
(F):5'- CTTCAGACTCAGAGGTGGTTCC -3'
(R):5'- TTACAGGGGAAAAGCCTTTCAAATG -3'

Sequencing Primer
(F):5'- AGACTCAGAGGTGGTTCCATTGC -3'
(R):5'- GCCTTTCAAATGTGAATTTGACGG -3'
Posted On2018-11-28