Incidental Mutation 'R6978:Mchr1'
ID542586
Institutional Source Beutler Lab
Gene Symbol Mchr1
Ensembl Gene ENSMUSG00000050164
Gene Namemelanin-concentrating hormone receptor 1
Synonymsmelanin-concentrating hormone receptor 1, Gpr24-9, Gpr24, Mch1r, MCH-1R
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R6978 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location81235499-81238964 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 81237796 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 249 (L249P)
Ref Sequence ENSEMBL: ENSMUSP00000126191 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166855]
Predicted Effect possibly damaging
Transcript: ENSMUST00000166855
AA Change: L249P

PolyPhen 2 Score 0.898 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000126191
Gene: ENSMUSG00000050164
AA Change: L249P

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 48 184 4e-6 PFAM
Pfam:7TM_GPCR_Srsx 51 325 3.6e-10 PFAM
Pfam:7tm_1 57 311 2.4e-45 PFAM
Meta Mutation Damage Score 0.1684 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency 96% (51/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, a member of the G protein-coupled receptor family 1, is an integral plasma membrane protein which binds melanin-concentrating hormone. The encoded protein can inhibit cAMP accumulation and stimulate intracellular calcium flux, and is probably involved in the neuronal regulation of food consumption. Although structurally similar to somatostatin receptors, this protein does not seem to bind somatostatin. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice for some alleles may display osteoporosis, resistance to diet-induced obesity, abnormal pyramidal neuron physiology, hyperactivity, polyphagia, increased heart rate and body temperature, sleep behavior, and impaired conditioned learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T C 18: 12,185,747 Y430H probably benign Het
6430628N08Rik C T 4: 115,898,363 Q120* probably null Het
Adprh C T 16: 38,445,809 G324S probably damaging Het
Amfr T C 8: 94,000,387 E140G probably damaging Het
Anapc1 G T 2: 128,669,900 Q458K probably benign Het
Ap1g1 T C 8: 109,828,336 probably null Het
Arhgap45 G T 10: 80,021,848 V211F probably benign Het
Baz2b T C 2: 59,907,715 E1750G possibly damaging Het
Cmpk2 A T 12: 26,477,019 T336S probably damaging Het
Col6a3 C T 1: 90,807,470 probably null Het
Cyp2c29 T C 19: 39,321,663 L272P probably damaging Het
Cyp3a13 A T 5: 137,905,539 S286T probably benign Het
Cyp4f18 T G 8: 72,002,496 S79R probably benign Het
Dio1 T C 4: 107,306,833 T96A probably benign Het
Dnah7a T C 1: 53,662,367 I210V probably null Het
Epha4 A G 1: 77,377,583 Y841H probably damaging Het
Gm10471 C A 5: 26,086,456 E117D probably damaging Het
Gm12695 T C 4: 96,769,722 D70G possibly damaging Het
Gtf3c1 G T 7: 125,645,534 T1680K possibly damaging Het
Hnrnpul2 T C 19: 8,824,276 V314A probably damaging Het
Irx3 G T 8: 91,800,728 P116Q probably damaging Het
Lrp4 C T 2: 91,491,998 R1060C probably damaging Het
Mark3 G A 12: 111,627,148 V205I probably benign Het
Med26 T C 8: 72,496,583 N224S possibly damaging Het
Megf9 C T 4: 70,433,529 V452I probably benign Het
Mki67 T C 7: 135,701,962 R726G probably benign Het
Mst1r T A 9: 107,912,594 L583Q probably benign Het
Mybpc1 A G 10: 88,523,024 C1102R probably damaging Het
Nr6a1 T C 2: 38,872,619 T55A probably benign Het
Nup210l G A 3: 90,154,566 R684Q possibly damaging Het
Olfr1303 T A 2: 111,813,810 L305F probably benign Het
Olfr538 A C 7: 140,574,287 I45L probably damaging Het
Olfr986 C T 9: 40,187,789 R225W probably damaging Het
Pgbd1 A G 13: 21,423,262 L254P probably damaging Het
Pou6f2 A G 13: 18,172,478 F10L probably damaging Het
Ppfia3 T A 7: 45,346,848 T726S probably benign Het
Rab21 T A 10: 115,298,861 M118L possibly damaging Het
Rbm6 T C 9: 107,852,575 probably null Het
Rpp38 A G 2: 3,329,721 L48P probably damaging Het
Sart3 A T 5: 113,745,746 I735N probably damaging Het
Slc44a1 T A 4: 53,544,671 Y461N probably damaging Het
Smok2b A T 17: 13,236,408 *485L probably null Het
Spink8 T C 9: 109,820,657 V69A probably benign Het
Spred2 G A 11: 19,998,254 R83Q possibly damaging Het
Tmc1 T C 19: 20,804,635 N573S probably damaging Het
Tox4 G T 14: 52,287,237 probably null Het
Unc13c T C 9: 73,931,977 S531G probably benign Het
Vmn2r56 C T 7: 12,715,406 V302I probably benign Het
Ypel1 C T 16: 17,084,574 A110V probably benign Het
Zfp395 G A 14: 65,386,433 R117H probably benign Het
Zic5 T C 14: 122,459,548 T552A unknown Het
Zic5 CGACGAGTAG C 14: 122,459,555 probably benign Het
Other mutations in Mchr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01834:Mchr1 APN 15 81237865 missense probably damaging 1.00
IGL02364:Mchr1 APN 15 81237279 missense probably benign 0.36
Ketogenic UTSW 15 81237868 missense probably damaging 1.00
PIT4366001:Mchr1 UTSW 15 81237216 missense probably benign 0.01
R0412:Mchr1 UTSW 15 81235747 start gained probably benign
R1554:Mchr1 UTSW 15 81235820 missense probably benign 0.02
R1706:Mchr1 UTSW 15 81237163 missense probably damaging 0.99
R1771:Mchr1 UTSW 15 81237235 missense probably damaging 1.00
R5522:Mchr1 UTSW 15 81238010 missense possibly damaging 0.64
R5930:Mchr1 UTSW 15 81237843 missense probably damaging 1.00
R6516:Mchr1 UTSW 15 81237868 missense probably damaging 1.00
R6612:Mchr1 UTSW 15 81237870 missense probably damaging 0.99
R7583:Mchr1 UTSW 15 81237441 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- CACTCCTGTGTGGCTCTATG -3'
(R):5'- CTATGTACACAAAGGGATTGAGGC -3'

Sequencing Primer
(F):5'- GCTCTATGCCAGGCTTATCC -3'
(R):5'- CAAAGGGATTGAGGCAGCTGTTG -3'
Posted On2018-11-28