Incidental Mutation 'R6979:Ptgs1'
ID542598
Institutional Source Beutler Lab
Gene Symbol Ptgs1
Ensembl Gene ENSMUSG00000047250
Gene Nameprostaglandin-endoperoxide synthase 1
SynonymsPghs1, Cox-3, COX1, Cox-1, cyclooxygenase 1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.457) question?
Stock #R6979 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location36230426-36252272 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36251299 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 586 (D586G)
Ref Sequence ENSEMBL: ENSMUSP00000059977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062069]
Predicted Effect probably benign
Transcript: ENSMUST00000062069
AA Change: D586G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000059977
Gene: ENSMUSG00000047250
AA Change: D586G

DomainStartEndE-ValueType
low complexity region 5 26 N/A INTRINSIC
EGF 37 72 2.48e1 SMART
low complexity region 172 185 N/A INTRINSIC
low complexity region 200 214 N/A INTRINSIC
Pfam:An_peroxidase 221 528 1.5e-46 PFAM
Meta Mutation Damage Score 0.1527 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: This is one of two genes encoding similar enzymes that catalyze the conversion of arachinodate to prostaglandin. The encoded protein regulates angiogenesis in endothelial cells, and is inhibited by nonsteroidal anti-inflammatory drugs such as aspirin. Based on its ability to function as both a cyclooxygenase and as a peroxidase, the encoded protein has been identified as a moonlighting protein. [provided by RefSeq, Jan 2014]
PHENOTYPE: Null mutants show impaired platelet aggregation, reduced inflammatory responses, and diminished susceptibility to induced papillomas. Female mutants exhibit delayed parturition and their offspring die neonatally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac C T 3: 60,040,003 T374M probably benign Het
Aspg A G 12: 112,120,944 D278G possibly damaging Het
Aspm C A 1: 139,480,485 A2370E probably damaging Het
Ccnt2 T C 1: 127,775,136 M65T probably damaging Het
Cd163 A G 6: 124,317,986 T670A probably benign Het
Cpne3 G A 4: 19,533,098 T279I probably benign Het
Ctdspl G A 9: 119,040,530 V227M probably damaging Het
Ctnnd2 A G 15: 30,619,230 E99G probably damaging Het
Dapk1 T C 13: 60,748,281 S728P probably damaging Het
Dmxl2 A G 9: 54,450,879 I512T possibly damaging Het
Dopey1 A T 9: 86,521,642 T1630S possibly damaging Het
Dqx1 A G 6: 83,061,011 D460G probably damaging Het
Foxg1 T C 12: 49,384,784 probably benign Het
H2-Q2 T A 17: 35,345,647 probably null Het
Hes6 T C 1: 91,413,088 E17G possibly damaging Het
Ighv1-42 T C 12: 114,937,228 Y79C possibly damaging Het
Itfg2 T C 6: 128,411,591 D311G probably damaging Het
Itgb5 T A 16: 33,919,986 C489S probably damaging Het
Map4k5 A T 12: 69,822,848 C488S probably damaging Het
Mark1 C T 1: 184,912,628 G377D possibly damaging Het
Mat2a A G 6: 72,435,113 V318A probably damaging Het
Mpp7 T G 18: 7,355,049 N459T possibly damaging Het
Mrc2 C A 11: 105,348,635 N1348K probably damaging Het
Mroh5 T C 15: 73,793,129 K264R probably benign Het
Mtor A G 4: 148,524,473 M1529V possibly damaging Het
Mtrr C T 13: 68,570,003 probably null Het
Nwd1 C T 8: 72,667,660 P517L probably damaging Het
Olfr1100 A G 2: 86,978,233 S188P probably damaging Het
Olfr1197 T A 2: 88,729,184 R138S probably benign Het
Polr1c A G 17: 46,246,169 F63L probably damaging Het
Polrmt C T 10: 79,746,566 probably null Het
Pomt2 T C 12: 87,130,351 I287M probably damaging Het
Prkar2a T A 9: 108,733,143 N190K possibly damaging Het
Prl3d3 T A 13: 27,157,562 Y59N possibly damaging Het
Prl5a1 T A 13: 28,151,206 F199L probably benign Het
Prpf38b A G 3: 108,911,324 V40A probably benign Het
Ptchd1 T A X: 155,574,712 Y499F probably damaging Het
Slx4 T C 16: 3,985,015 K1312E probably damaging Het
Smok3c A G 5: 138,064,725 D158G probably benign Het
Spen A T 4: 141,478,063 D1084E unknown Het
Tcp11l1 C T 2: 104,706,439 G27D probably benign Het
Tep1 A G 14: 50,838,637 S1679P possibly damaging Het
Tmem259 C T 10: 79,978,557 V322I possibly damaging Het
Tmpo A T 10: 91,152,497 probably null Het
Ttn C A 2: 76,724,793 A30623S probably damaging Het
Ube2l3 G A 16: 17,159,977 probably benign Het
Unkl A G 17: 25,199,916 D146G probably damaging Het
Vmn1r51 A T 6: 90,129,204 H34L possibly damaging Het
Vmn2r17 A G 5: 109,428,399 T379A possibly damaging Het
Zfp35 G T 18: 24,003,870 G424C probably benign Het
Zfp420 T A 7: 29,876,021 H555Q probably damaging Het
Other mutations in Ptgs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Ptgs1 APN 2 36237219 missense probably damaging 1.00
IGL02345:Ptgs1 APN 2 36242971 missense probably null 0.93
IGL02952:Ptgs1 APN 2 36251241 missense probably benign 0.00
IGL03306:Ptgs1 APN 2 36237705 missense probably damaging 1.00
PIT4431001:Ptgs1 UTSW 2 36240680 missense probably damaging 1.00
R0468:Ptgs1 UTSW 2 36249193 missense probably damaging 1.00
R0638:Ptgs1 UTSW 2 36240856 splice site probably benign
R1563:Ptgs1 UTSW 2 36245202 missense possibly damaging 0.53
R1858:Ptgs1 UTSW 2 36242770 missense probably benign 0.19
R2012:Ptgs1 UTSW 2 36237656 missense probably benign
R2080:Ptgs1 UTSW 2 36242847 nonsense probably null
R2116:Ptgs1 UTSW 2 36237696 nonsense probably null
R4073:Ptgs1 UTSW 2 36237776 missense probably damaging 1.00
R4163:Ptgs1 UTSW 2 36251334 missense possibly damaging 0.87
R4862:Ptgs1 UTSW 2 36237255 missense probably damaging 1.00
R5062:Ptgs1 UTSW 2 36237282 missense probably damaging 1.00
R5071:Ptgs1 UTSW 2 36251260 missense probably damaging 1.00
R5072:Ptgs1 UTSW 2 36251260 missense probably damaging 1.00
R5073:Ptgs1 UTSW 2 36251260 missense probably damaging 1.00
R5074:Ptgs1 UTSW 2 36251260 missense probably damaging 1.00
R5373:Ptgs1 UTSW 2 36251186 missense probably damaging 1.00
R5374:Ptgs1 UTSW 2 36251186 missense probably damaging 1.00
R5419:Ptgs1 UTSW 2 36237222 missense probably damaging 1.00
R5428:Ptgs1 UTSW 2 36245268 missense probably benign 0.00
R5918:Ptgs1 UTSW 2 36251077 missense probably damaging 1.00
R6134:Ptgs1 UTSW 2 36251178 missense probably damaging 1.00
R6181:Ptgs1 UTSW 2 36251119 missense probably damaging 1.00
R6240:Ptgs1 UTSW 2 36237285 missense probably damaging 1.00
R7020:Ptgs1 UTSW 2 36251029 missense probably damaging 1.00
R7445:Ptgs1 UTSW 2 36245210 missense probably benign 0.06
R7557:Ptgs1 UTSW 2 36245211 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CAGCCCAACTCCATCTTTGG -3'
(R):5'- ACAATATTCTAGGCAAGGGTAAGACC -3'

Sequencing Primer
(F):5'- TATGATAGAGATGGGGGCTCC -3'
(R):5'- GACCCAAAGTTTCAAATGTGAGC -3'
Posted On2018-11-28