Incidental Mutation 'R6979:Olfr1197'
ID542601
Institutional Source Beutler Lab
Gene Symbol Olfr1197
Ensembl Gene ENSMUSG00000075119
Gene Nameolfactory receptor 1197
SynonymsMOR225-10P, GA_x6K02T2Q125-50202854-50201910, MOR225-14
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R6979 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location88726903-88732366 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 88729184 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 138 (R138S)
Ref Sequence ENSEMBL: ENSMUSP00000150290 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099815] [ENSMUST00000213118]
Predicted Effect probably benign
Transcript: ENSMUST00000099815
AA Change: R138S

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000097403
Gene: ENSMUSG00000075119
AA Change: R138S

DomainStartEndE-ValueType
Pfam:7tm_4 29 302 1.3e-45 PFAM
Pfam:7tm_1 39 285 7.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213118
AA Change: R138S

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac C T 3: 60,040,003 T374M probably benign Het
Aspg A G 12: 112,120,944 D278G possibly damaging Het
Aspm C A 1: 139,480,485 A2370E probably damaging Het
Ccnt2 T C 1: 127,775,136 M65T probably damaging Het
Cd163 A G 6: 124,317,986 T670A probably benign Het
Cpne3 G A 4: 19,533,098 T279I probably benign Het
Ctdspl G A 9: 119,040,530 V227M probably damaging Het
Ctnnd2 A G 15: 30,619,230 E99G probably damaging Het
Dapk1 T C 13: 60,748,281 S728P probably damaging Het
Dmxl2 A G 9: 54,450,879 I512T possibly damaging Het
Dopey1 A T 9: 86,521,642 T1630S possibly damaging Het
Dqx1 A G 6: 83,061,011 D460G probably damaging Het
Foxg1 T C 12: 49,384,784 probably benign Het
H2-Q2 T A 17: 35,345,647 probably null Het
Hes6 T C 1: 91,413,088 E17G possibly damaging Het
Ighv1-42 T C 12: 114,937,228 Y79C possibly damaging Het
Itfg2 T C 6: 128,411,591 D311G probably damaging Het
Itgb5 T A 16: 33,919,986 C489S probably damaging Het
Map4k5 A T 12: 69,822,848 C488S probably damaging Het
Mark1 C T 1: 184,912,628 G377D possibly damaging Het
Mat2a A G 6: 72,435,113 V318A probably damaging Het
Mpp7 T G 18: 7,355,049 N459T possibly damaging Het
Mrc2 C A 11: 105,348,635 N1348K probably damaging Het
Mroh5 T C 15: 73,793,129 K264R probably benign Het
Mtor A G 4: 148,524,473 M1529V possibly damaging Het
Mtrr C T 13: 68,570,003 probably null Het
Nwd1 C T 8: 72,667,660 P517L probably damaging Het
Olfr1100 A G 2: 86,978,233 S188P probably damaging Het
Polr1c A G 17: 46,246,169 F63L probably damaging Het
Polrmt C T 10: 79,746,566 probably null Het
Pomt2 T C 12: 87,130,351 I287M probably damaging Het
Prkar2a T A 9: 108,733,143 N190K possibly damaging Het
Prl3d3 T A 13: 27,157,562 Y59N possibly damaging Het
Prl5a1 T A 13: 28,151,206 F199L probably benign Het
Prpf38b A G 3: 108,911,324 V40A probably benign Het
Ptchd1 T A X: 155,574,712 Y499F probably damaging Het
Ptgs1 A G 2: 36,251,299 D586G probably benign Het
Slx4 T C 16: 3,985,015 K1312E probably damaging Het
Smok3c A G 5: 138,064,725 D158G probably benign Het
Spen A T 4: 141,478,063 D1084E unknown Het
Tcp11l1 C T 2: 104,706,439 G27D probably benign Het
Tep1 A G 14: 50,838,637 S1679P possibly damaging Het
Tmem259 C T 10: 79,978,557 V322I possibly damaging Het
Tmpo A T 10: 91,152,497 probably null Het
Ttn C A 2: 76,724,793 A30623S probably damaging Het
Ube2l3 G A 16: 17,159,977 probably benign Het
Unkl A G 17: 25,199,916 D146G probably damaging Het
Vmn1r51 A T 6: 90,129,204 H34L possibly damaging Het
Vmn2r17 A G 5: 109,428,399 T379A possibly damaging Het
Zfp35 G T 18: 24,003,870 G424C probably benign Het
Zfp420 T A 7: 29,876,021 H555Q probably damaging Het
Other mutations in Olfr1197
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Olfr1197 APN 2 88729065 missense probably damaging 1.00
IGL01515:Olfr1197 APN 2 88729008 missense probably benign
IGL01822:Olfr1197 APN 2 88728792 missense probably benign 0.03
IGL02060:Olfr1197 APN 2 88729563 missense probably damaging 0.98
IGL02466:Olfr1197 APN 2 88729395 missense probably damaging 1.00
IGL02698:Olfr1197 APN 2 88729471 missense probably damaging 1.00
R0336:Olfr1197 UTSW 2 88729154 missense possibly damaging 0.47
R1037:Olfr1197 UTSW 2 88729032 missense probably damaging 1.00
R1120:Olfr1197 UTSW 2 88728937 missense probably damaging 1.00
R1674:Olfr1197 UTSW 2 88729257 missense probably damaging 0.99
R1801:Olfr1197 UTSW 2 88729264 missense probably damaging 1.00
R1860:Olfr1197 UTSW 2 88729330 missense probably damaging 1.00
R1861:Olfr1197 UTSW 2 88729330 missense probably damaging 1.00
R2049:Olfr1197 UTSW 2 88728745 missense probably damaging 1.00
R2308:Olfr1197 UTSW 2 88729084 missense probably damaging 0.97
R2411:Olfr1197 UTSW 2 88729397 missense probably benign 0.06
R4707:Olfr1197 UTSW 2 88728712 missense possibly damaging 0.62
R5000:Olfr1197 UTSW 2 88729566 missense probably damaging 0.96
R5157:Olfr1197 UTSW 2 88729548 missense probably benign
R6000:Olfr1197 UTSW 2 88729231 missense probably damaging 1.00
R6021:Olfr1197 UTSW 2 88728950 nonsense probably null
R6389:Olfr1197 UTSW 2 88728672 missense probably benign 0.00
R6636:Olfr1197 UTSW 2 88728841 missense probably benign 0.01
R6637:Olfr1197 UTSW 2 88728841 missense probably benign 0.01
R7618:Olfr1197 UTSW 2 88728836 nonsense probably null
X0020:Olfr1197 UTSW 2 88729381 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCACCATCCCAGAGTTGG -3'
(R):5'- ACCTCCACTGTGATTCCCAG -3'

Sequencing Primer
(F):5'- CATCCCAGAGTTGGCAATTG -3'
(R):5'- TGTGATTCCCAGGCTCATCAGG -3'
Posted On2018-11-28