Incidental Mutation 'R6979:Itfg2'
ID542614
Institutional Source Beutler Lab
Gene Symbol Itfg2
Ensembl Gene ENSMUSG00000001518
Gene Nameintegrin alpha FG-GAP repeat containing 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R6979 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location128409444-128424931 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 128411591 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 311 (D311G)
Ref Sequence ENSEMBL: ENSMUSP00000145323 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001559] [ENSMUST00000001561] [ENSMUST00000120405] [ENSMUST00000123867] [ENSMUST00000142615] [ENSMUST00000203026] [ENSMUST00000203374] [ENSMUST00000203853] [ENSMUST00000204223] [ENSMUST00000204836]
Predicted Effect possibly damaging
Transcript: ENSMUST00000001559
AA Change: D343G

PolyPhen 2 Score 0.715 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000001559
Gene: ENSMUSG00000001518
AA Change: D343G

DomainStartEndE-ValueType
Pfam:Itfg2 49 382 1e-158 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000001561
SMART Domains Protein: ENSMUSP00000001561
Gene: ENSMUSG00000001520

DomainStartEndE-ValueType
Pfam:Asp_protease 88 203 1.2e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120405
SMART Domains Protein: ENSMUSP00000113317
Gene: ENSMUSG00000001520

DomainStartEndE-ValueType
Pfam:Asp_protease 88 202 1.1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123867
SMART Domains Protein: ENSMUSP00000122558
Gene: ENSMUSG00000001520

DomainStartEndE-ValueType
Pfam:Asp_protease 105 218 4.1e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000142615
AA Change: D343G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000145111
Gene: ENSMUSG00000001518
AA Change: D343G

DomainStartEndE-ValueType
Pfam:Itfg2 49 358 1e-139 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147155
SMART Domains Protein: ENSMUSP00000122305
Gene: ENSMUSG00000001520

DomainStartEndE-ValueType
low complexity region 96 111 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203026
SMART Domains Protein: ENSMUSP00000145388
Gene: ENSMUSG00000001518

DomainStartEndE-ValueType
Pfam:Itfg2 49 130 3.9e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000203374
AA Change: D311G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145323
Gene: ENSMUSG00000001518
AA Change: D311G

DomainStartEndE-ValueType
Pfam:Itfg2 21 350 1.3e-147 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203853
SMART Domains Protein: ENSMUSP00000145282
Gene: ENSMUSG00000001518

DomainStartEndE-ValueType
Pfam:Itfg2 49 85 3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203984
Predicted Effect probably benign
Transcript: ENSMUST00000204223
SMART Domains Protein: ENSMUSP00000145012
Gene: ENSMUSG00000108011

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
low complexity region 190 201 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204836
SMART Domains Protein: ENSMUSP00000144750
Gene: ENSMUSG00000001520

DomainStartEndE-ValueType
Pfam:Asp_protease 28 141 8.9e-6 PFAM
Meta Mutation Damage Score 0.3043 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency 100% (50/50)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit abnormal B cell differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac C T 3: 60,040,003 T374M probably benign Het
Aspg A G 12: 112,120,944 D278G possibly damaging Het
Aspm C A 1: 139,480,485 A2370E probably damaging Het
Ccnt2 T C 1: 127,775,136 M65T probably damaging Het
Cd163 A G 6: 124,317,986 T670A probably benign Het
Cpne3 G A 4: 19,533,098 T279I probably benign Het
Ctdspl G A 9: 119,040,530 V227M probably damaging Het
Ctnnd2 A G 15: 30,619,230 E99G probably damaging Het
Dapk1 T C 13: 60,748,281 S728P probably damaging Het
Dmxl2 A G 9: 54,450,879 I512T possibly damaging Het
Dopey1 A T 9: 86,521,642 T1630S possibly damaging Het
Dqx1 A G 6: 83,061,011 D460G probably damaging Het
Foxg1 T C 12: 49,384,784 probably benign Het
H2-Q2 T A 17: 35,345,647 probably null Het
Hes6 T C 1: 91,413,088 E17G possibly damaging Het
Ighv1-42 T C 12: 114,937,228 Y79C possibly damaging Het
Itgb5 T A 16: 33,919,986 C489S probably damaging Het
Map4k5 A T 12: 69,822,848 C488S probably damaging Het
Mark1 C T 1: 184,912,628 G377D possibly damaging Het
Mat2a A G 6: 72,435,113 V318A probably damaging Het
Mpp7 T G 18: 7,355,049 N459T possibly damaging Het
Mrc2 C A 11: 105,348,635 N1348K probably damaging Het
Mroh5 T C 15: 73,793,129 K264R probably benign Het
Mtor A G 4: 148,524,473 M1529V possibly damaging Het
Mtrr C T 13: 68,570,003 probably null Het
Nwd1 C T 8: 72,667,660 P517L probably damaging Het
Olfr1100 A G 2: 86,978,233 S188P probably damaging Het
Olfr1197 T A 2: 88,729,184 R138S probably benign Het
Polr1c A G 17: 46,246,169 F63L probably damaging Het
Polrmt C T 10: 79,746,566 probably null Het
Pomt2 T C 12: 87,130,351 I287M probably damaging Het
Prkar2a T A 9: 108,733,143 N190K possibly damaging Het
Prl3d3 T A 13: 27,157,562 Y59N possibly damaging Het
Prl5a1 T A 13: 28,151,206 F199L probably benign Het
Prpf38b A G 3: 108,911,324 V40A probably benign Het
Ptchd1 T A X: 155,574,712 Y499F probably damaging Het
Ptgs1 A G 2: 36,251,299 D586G probably benign Het
Slx4 T C 16: 3,985,015 K1312E probably damaging Het
Smok3c A G 5: 138,064,725 D158G probably benign Het
Spen A T 4: 141,478,063 D1084E unknown Het
Tcp11l1 C T 2: 104,706,439 G27D probably benign Het
Tep1 A G 14: 50,838,637 S1679P possibly damaging Het
Tmem259 C T 10: 79,978,557 V322I possibly damaging Het
Tmpo A T 10: 91,152,497 probably null Het
Ttn C A 2: 76,724,793 A30623S probably damaging Het
Ube2l3 G A 16: 17,159,977 probably benign Het
Unkl A G 17: 25,199,916 D146G probably damaging Het
Vmn1r51 A T 6: 90,129,204 H34L possibly damaging Het
Vmn2r17 A G 5: 109,428,399 T379A possibly damaging Het
Zfp35 G T 18: 24,003,870 G424C probably benign Het
Zfp420 T A 7: 29,876,021 H555Q probably damaging Het
Other mutations in Itfg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02088:Itfg2 APN 6 128411606 missense probably benign 0.02
IGL02111:Itfg2 APN 6 128410381 missense probably benign 0.01
IGL02337:Itfg2 APN 6 128413570 missense probably benign 0.02
IGL02611:Itfg2 APN 6 128424725 missense probably damaging 1.00
R0492:Itfg2 UTSW 6 128413523 critical splice donor site probably null
R1462:Itfg2 UTSW 6 128424728 missense probably damaging 1.00
R1462:Itfg2 UTSW 6 128424728 missense probably damaging 1.00
R2960:Itfg2 UTSW 6 128413552 missense probably benign 0.33
R3110:Itfg2 UTSW 6 128411669 missense probably damaging 1.00
R3112:Itfg2 UTSW 6 128411669 missense probably damaging 1.00
R4067:Itfg2 UTSW 6 128410450 intron probably benign
R4866:Itfg2 UTSW 6 128416316 intron probably benign
R4900:Itfg2 UTSW 6 128416316 intron probably benign
R6623:Itfg2 UTSW 6 128411657 missense probably damaging 1.00
R7031:Itfg2 UTSW 6 128416054 missense probably damaging 0.99
R7162:Itfg2 UTSW 6 128410583 missense probably damaging 0.98
R7660:Itfg2 UTSW 6 128424746 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCCATGACCACTAGTGACAG -3'
(R):5'- CCAGAGTCAAGTTCATGGTCC -3'

Sequencing Primer
(F):5'- GCTAAGGAGCCCATTCAGG -3'
(R):5'- CAGAGTCAAGTTCATGGTCCTTTATG -3'
Posted On2018-11-28